Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CALML3-calmodulin-like 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CALML3-calmodulin-like 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031889 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CALML3 |
| Origin species: | Human |
| Product name: | CALML3-calmodulin-like 3 Gene |
| Size: | 2ug |
| Accessions: | BC031889 |
| Gene id: | 810 |
| Gene description: | calmodulin-like 3 |
| Synonyms: | CLP; calmodulin-like protein 3; caM-like protein; calmodulin-related protein NB-1; calmodulin like 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgaccagctgactgaggagcaggtcacagaattcaaggaggccttctccctgtttgacaaggatggggacggctgcatcaccacccgcgagctgggcacggtcatgcggtccctgggccagaaccccacggaggccgagctgcgggacatgatgagtgagatcgaccgggacggcaacggcaccgtggacttccccgagttcctgggcatgatggccaggaagatgaaggacacggacaacgaggaggagatccgcgaggccttccgcgtgttcgacaaggacggcaacggcttcgtcagcgccgccgagctgcgacacgtcatgacccggctgggggagaagctgagtgacgaggaggtggacgagatgatccgggccgcggacacggacggagacggacaggtgaactacgaggagtttgtccgtgtgctggtgtccaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Rho family GTPase 3 - interleukin 1, beta - FOS-like antigen 1 - lactamase, beta 2 |