Login to display prices
Login to display prices
CALML3-calmodulin-like 3 Gene View larger

CALML3-calmodulin-like 3 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CALML3-calmodulin-like 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CALML3-calmodulin-like 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031889
Product type: DNA & cDNA
Ncbi symbol: CALML3
Origin species: Human
Product name: CALML3-calmodulin-like 3 Gene
Size: 2ug
Accessions: BC031889
Gene id: 810
Gene description: calmodulin-like 3
Synonyms: CLP; calmodulin-like protein 3; caM-like protein; calmodulin-related protein NB-1; calmodulin like 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgaccagctgactgaggagcaggtcacagaattcaaggaggccttctccctgtttgacaaggatggggacggctgcatcaccacccgcgagctgggcacggtcatgcggtccctgggccagaaccccacggaggccgagctgcgggacatgatgagtgagatcgaccgggacggcaacggcaccgtggacttccccgagttcctgggcatgatggccaggaagatgaaggacacggacaacgaggaggagatccgcgaggccttccgcgtgttcgacaaggacggcaacggcttcgtcagcgccgccgagctgcgacacgtcatgacccggctgggggagaagctgagtgacgaggaggtggacgagatgatccgggccgcggacacggacggagacggacaggtgaactacgaggagtttgtccgtgtgctggtgtccaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Rho family GTPase 3
- interleukin 1, beta
- FOS-like antigen 1
- lactamase, beta 2