Magmas-mitochondria-associated protein involved in granulocyte-macrophage colony-stimulating factor signal transduction Gene View larger

Magmas-mitochondria-associated protein involved in granulocyte-macrophage colony-stimulating factor signal transduction Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of Magmas-mitochondria-associated protein involved in granulocyte-macrophage colony-stimulating factor signal transduction Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about Magmas-mitochondria-associated protein involved in granulocyte-macrophage colony-stimulating factor signal transduction Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005024
Product type: DNA & cDNA
Ncbi symbol: Magmas
Origin species: Human
Product name: Magmas-mitochondria-associated protein involved in granulocyte-macrophage colony-stimulating factor signal transduction Gene
Size: 2ug
Accessions: BC005024
Gene id: 51025
Gene description: mitochondria-associated protein involved in granulocyte-macrophage colony-stimulating factor signal transduction
Synonyms: magmas-like protein; MAGMAS; CGI-136; SMDMDM; TIM16; TIMM16; mitochondrial import inner membrane translocase subunit TIM16; mitochondria associated protein involved in granulocyte macrophage colony stimulating factor signal transduction; mitochondria-associated granulocyte macrophage CSF-signaling molecule; presequence translocase associated motor 16 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaagtacctggcccagatcattgtgatgggcgtgcaggtggtgggcagggcctttgcacgggccttgcggcaggagtttgcagccagccgggccgcagctgatgcccgaggacgcgctggacaccggtctgcagccgcttccaacctctccggcctcagcctccaggaggcacagcagattctcaacgtgtccaagctgagccctgaggaggtccagaagaactatgaacacttatttaaggtgaatgataaatccgtgggtggctccttctacctgcagtcaaaggtggtccgcgcaaaggagcgcctggatgaggaactcaaaatccaggcccaggaggacagagaaaaagggcagatgccccatacgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

Buy Magmas-mitochondria-associated protein involved in granulocyte-macrophage colony-stimulating factor signal transduction Gene now

Add to cart