ZNF595-zinc finger protein 595 Gene View larger

ZNF595-zinc finger protein 595 Gene


New product

Data sheet of ZNF595-zinc finger protein 595 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF595-zinc finger protein 595 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036110
Product type: DNA & cDNA
Ncbi symbol: ZNF595
Origin species: Human
Product name: ZNF595-zinc finger protein 595 Gene
Size: 2ug
Accessions: BC036110
Gene id: 152687
Gene description: zinc finger protein 595
Synonyms: zinc finger protein 595
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaactcgtaacattcagggatgtggccatagaattctcccctgaagagtggaaatgtctggaccctgcccagcagaatttgtatagagatgtgatgttggagaactacaggaacctggtctccctgggttttgtgatctctaacccagacctggtcacctgtctggagcaaataaaagagccctgcaatttgaagatacatgagacagcagccaaacccccagctatatgttctcctttcagccaagacctttcaccagtgcaggggatagaagattcattccacaaacttatactgaaaagatacgagaaatgtggacatgagaatttacaattaagaaaaggttgtaaacgtgtgaatgagtgtaaggtgcagaaaggagttaataatggagtttaccagtgcttgtcaactacccagagcaaaatatttcaatgtaatacatgtgttaaagtttttagtaaattttcaaattcaaacaaacataagataagacatactggagagaaaccctttaaatgtacagaatgtggcagatcgttttacatgtcacacctaactcaacatacaggaattcatgctggagagaaaccctacaaatgtgaaaaatgtggcaaagcctttaataggtccacatcacttagtaaacataagagaattcatactggagagaaaccctacacatgtgaagaatgtggcaaagcctttagacggtccacagttctgaacgaacataagaaaattcatactggagagaaaccctacaaatgtgaagaatgtggcaaagcctttacaaggtccacaacactgaatgaacacaagaaaattcatactggagagaaaccctacaaatgtaaagaatgtggcaaagcctttagatggtccacaagcatgaatgaacataagaatattcatactggagagaaaccctacaaatgtaaagaatgtggcaaagcctttagacagtccaggagcctgaatgaacataaaaatattcatactggcgaaaaaccctacacatgtgaaaaatgtggcaaagcttttaaccaatcctcaagtcttattatacacaggagcattcattctgaacaaaaactttacaaatgtgaagaatgtggcaaagcctttacttggtcctcatcccttaataaacataagagaattcatactggagagaaaccctacgcatgtgaagaatgtggcaaagctttttataggtcctcacaccttgctaaacataagagaattcatactggagagaaaccctacacgtgcgaagaatgtggcaaagcttttaaccaatcctcaactcttatattacacaagagaatccattctgggcaaaaaccttacaaatgtgaagaatgtggcaaagcctttacacggtccacaacactgaacgaacataagaaaattcatactggcgagaaaccctacaaatgtgaagaatgtggcaaagctttcatatggtccgcaagcctgaatgaacataagaatattcatactggagagaaaccctacaaatgtaaagaatgtggcaaagcttttaaccaatcctcaggccttattatacacaggagcattcattctgaacaaaaactttacaaatgtgaagaatgtggcaaagcctttactcggtccacagccctgaatgaacataagaaaattcattctggagagaaaccctacaaatgcaaagaatgtggcaaagcctataacttatcctcaacccttactaaacataagagaattcatactggagagaaacccttcacatgtgaagaatgtggcaaagccttcaattggtcctcatcccttactaaacataagataattcatactggagagaaatcctacaaatgtgaagaatgtggcaaagcttttaatcggccctcaacccttactgtacacaagcgaattcatactggcaaggaacatagttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 202
- zinc finger protein 274
- zinc finger protein 334
- ring finger protein 103

Buy ZNF595-zinc finger protein 595 Gene now

Add to cart