ATXN3-ataxin 3 Gene View larger

ATXN3-ataxin 3 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATXN3-ataxin 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ATXN3-ataxin 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033711
Product type: DNA & cDNA
Ncbi symbol: ATXN3
Origin species: Human
Product name: ATXN3-ataxin 3 Gene
Size: 2ug
Accessions: BC033711
Gene id: 4287
Gene description: ataxin 3
Synonyms: AT3; ATX3; JOS; MJD; MJD1; SCA3; ataxin-3; Machado-Joseph disease (spinocerebellar ataxia 3, olivopontocerebellar ataxia 3, autosomal dominant, ataxin 3); Machado-Joseph disease protein 1; ataxin 3 variant an; ataxin 3 variant ao; ataxin 3 variant at; ataxin 3 variant e; ataxin 3 variant h; ataxin 3 variant m; ataxin 3 variant r; ataxin 3 variant ref; ataxin 3 variant y; josephin; olivopontocerebellar ataxia 3; spinocerebellar ataxia type 3 protein; ataxin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtccatcttccacgagaaacaagaaggctcactttgtgctcaacattgcctgaataacttattgcaaggagaatattttagccccgtggaattatcctcaattgcacatcagctggatgaggaggagaggatgagaatggcagaaggaggagttactagtgaagattatcgcacgtttttacagcagccttctggaaatatggatgacagtggttttttctctattcaggttataagcaatgccttgaaagtttggggtttagaactaatcctgttcaacagtccagagtatcagaggctcaggatcgatcctataaatgaaagatcatttatatgcaattataaggaacactggtttacagttagaaaattaggaaaacagtggtttaacttgaattctctcttgacgggtccagaattaatatcagatacatatcttgcacttttcttggctcaattacaacaggaaggttattctatatttgtcgttaagggtgatctgccagattgcgaagctgaccaactcctgcagatgattagggtccaacagatgcatcgaccaaaacttattggagaagaattagcacaactaaaagagcaaagagtccataaaacagacctggaacgagtgttagaagcaaatgatggctcaggaatgttagacgaagatgaggaggatttgcagagggctctggcactaagtcgccaagaaattgacatggaagatgaggaagcagatctccgcagggctattcagctaagtatgcaaggtagttccagaaacatatctcaagatatgacacagacatcaggtacaaatcttacttcagaagagcttcggaagagacgagaagcctactttgaaaaacagcagcaaaagcagcaacagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagggggacctatcaggacagagttcacatccatgtgaaaggccagccaccagttcaggagcacttgggagtgatctaggtgatgctatgagtgaagaagacatgcttcaggcagctgtgaccatgtctttagaaactgtcagaaatgatttgaaaacagaaggaaaaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - septin 6
- septin 6
- tektin 4
- septin 9

Buy ATXN3-ataxin 3 Gene now

Add to cart