HACL1-2-hydroxyacyl-CoA lyase 1 Gene View larger

HACL1-2-hydroxyacyl-CoA lyase 1 Gene

PTXBC001627

New product

Data sheet of HACL1-2-hydroxyacyl-CoA lyase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HACL1-2-hydroxyacyl-CoA lyase 1 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC001627
Product type: DNA & cDNA
Ncbi symbol: HACL1
Origin species: Human
Product name: HACL1-2-hydroxyacyl-CoA lyase 1 Gene
Size: 2ug
Accessions: BC001627
Gene id: 26061
Gene description: 2-hydroxyacyl-CoA lyase 1
Synonyms: 2-HPCL; HPCL; HPCL2; PHYH2; 2-hydroxyacyl-CoA lyase 1; 1600020H07Rik; 2-hydroxyphytanol-CoA lyase; 2-hydroxyphytanoyl-CoA lyase; phytanoyl-CoA 2-hydroxylase 2; phytanoyl-CoA hydroxylase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggacagtaacttcgcagagcgcagcgaggagcaggtgtctggtgctaaagtcatcgctcaggccctgaaaacgcaagatgtggagtacatatttggcatcgtaggcatcccagtgaccgaaatcgccattgctgcccagcagctaggcatcaagtacatcgggatgaggaatgagcaagcggcttgttatgctgcctccgcgattggatatctgacaagcaggccaggagtctgccttgttgtttctggcccaggtctcatccatgccttgggcggtatggcaaatgcaaacatgaactgctggcccttgcttgtgattggtggttcctctgaaagaaaccaagaaacaatgggagctttccaggagtttcctcaggttgaagcttgtagattatataccaagttctctgcccgcccaagcagcatagaagctattccttttgttattgaaaaggcagtgagaagcagtatctatggtcgtccaggtgcttgctatgttgacataccagcagattttgtgaaccttcaggtgaatgtgaattctataaagtacatggaacgctgcatgtcacctcctattagcatggcagaaacctctgctgtgtgcacggcggcttctgttattaggaatgccaaacaaccccttcttatcatcgggaaaggtgctgcttacgctcatgcagaagagagtatcaagaaattggtggagcaatataaactgccatttttgcccacccctatggggaagggtgttgtccctgacaaccatccatactgtgtaggtgcagccagatccagggctttgcaatttgctgatgtaattgtgttatttggtgccagactaaattggattttacattttggactgcctccaagatatcagccagatgtgaagtttatccaggttgatatctgtgcagaagaattggggaataatgtaaagcccgctgttactttgctaggaaacatacatgctgtcactaagcagcttttagaggaacttgataaaacaccatggcagtatcctccagagagcaagtggtggaaaactctgagagaaaaaatgaagagcaatgaagctgcatccaaggaactagcttctaaaaaatccctgcctatgaattattacacagtattctaccatgttcaagaacaactacctagagactgtttcgtggtaagtgaaggagcaaatactatggacattggacggactgtgcttcagaactaccttcctcgtcacaggcttgatgctggtactttcggaacaatgggagttggtttgggatttgctattgcagctgccgtggtggctaaagatagaagccctgggcaatggatcatctgtgtggaaggagacagtgcatttgggttttctggcatggaggtagaaaccatctgcaggtacaacttgccaatcatactgttggtagtgaataacaatggaatttaccaaggttttgatacagatacttggaaagaaatgttaaaatttcaagatgctactgcagtggtccctccaatgtgtttgctgccaaattcacattatgagcaagtcatgactgcatttggaggcaaagggtattttgtacaaacaccagaagaactccaaaaatccctgaggcagagcctagcagacacaactaaaccttctcttatcaacatcatgattgagccccaagccacacggaaggcccaggattttcattggctgacccgctctaatatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - YY1 associated protein 1
- YY1 associated protein 1
- phosphofructokinase, liver
- cadherin 16, KSP-cadherin

Buy HACL1-2-hydroxyacyl-CoA lyase 1 Gene now

Add to cart