MB-myoglobin Gene View larger

MB-myoglobin Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MB-myoglobin Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MB-myoglobin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014547
Product type: DNA & cDNA
Ncbi symbol: MB
Origin species: Human
Product name: MB-myoglobin Gene
Size: 2ug
Accessions: BC014547
Gene id: 4151
Gene description: myoglobin
Synonyms: PVALB; myoglobgin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggctcagcgacggggaatggcagttggtgctgaacgtctgggggaaggtggaggctgacatcccaggccatgggcaggaagtcctcatcaggctctttaagggtcacccagagactctggagaagtttgacaagttcaagcacctgaagtcagaggacgagatgaaggcatctgaggacttaaagaagcatggtgccactgtgctcaccgccctgggtggcatccttaagaagaaggggcatcatgaggcagagattaagcccctggcacagtcgcatgccaccaagcacaagatccccgtgaagtacctggagttcatctcggaatgcatcatccaggttctgcagagcaagcatcccggggactttggtgctgatgcccagggggccatgaacaaggccctggagctgttccggaaggacatggcctccaactacaaggagctgggcttccagggctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - epsin 3
- granulin
- endoglin
- tafazzin

Buy MB-myoglobin Gene now

Add to cart