Cart 1 Product Products 118,48 € (empty)
No products
To be determined Shipping
118,48 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 118,48 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 118,48 €
View larger 
PRKRIR-protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) Gene
PTXBC021992
New product
Data sheet of PRKRIR-protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRKRIR-protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021992 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRKRIR |
| Origin species: | Human |
| Product name: | PRKRIR-protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) Gene |
| Size: | 2ug |
| Accessions: | BC021992 |
| Gene id: | 5612 |
| Gene description: | protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) |
| Synonyms: | PRKRIR; DAP4; P52rIPK; THAP0; 52 kDa repressor of the inhibitor of the protein kinase; 58 kDa interferon-induced protein kinase-interacting protein; P58IPK-regulatory protein; THAP domain-containing protein 0; THAP domain-containing protein 12; death-associated protein 4; inhibitor of protein kinase PKR; p58IPK-interacting protein; protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor); testicular tissue protein Li 133; THAP domain containing 12 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggacaactcaaattcaatacgtcggaggaacaccatgctgacatgtatagaagtgacttacccaatcctgacacgctgtcagctgagcttcattgttggagaatcaaatggaaacacagggggaaagatatagagcttccgtccaccatctatgaagccctccacctgcctgacatcaagttttttcctaatgtgtatgcattgctgaaggtcctgtgtattcttcctgtgatgaaggttgagaatgagcggtatgaaaatggacgaaagcgtcttaaagcatatttgaggaacactttgacagaccaaaggtcaagtaacttggctttgcttaacataaattttgatataaaacacgacctggatttaatggtggacacatatattaaactctatacaagtaagtcagagcttcctacagataattccgaaactgtggaaaatacctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |