> >>PRKRIR-protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) Gene
PRKRIR-protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) Gene View larger

PRKRIR-protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) Gene

PTXBC021992

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of PRKRIR-protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PRKRIR-protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021992
Product type: DNA & cDNA
Ncbi symbol: PRKRIR
Origin species: Human
Product name: PRKRIR-protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) Gene
Size: 2ug
Accessions: BC021992
Gene id: 5612
Gene description: protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)
Synonyms: PRKRIR; DAP4; P52rIPK; THAP0; 52 kDa repressor of the inhibitor of the protein kinase; 58 kDa interferon-induced protein kinase-interacting protein; P58IPK-regulatory protein; THAP domain-containing protein 0; THAP domain-containing protein 12; death-associated protein 4; inhibitor of protein kinase PKR; p58IPK-interacting protein; protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor); testicular tissue protein Li 133; THAP domain containing 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggacaactcaaattcaatacgtcggaggaacaccatgctgacatgtatagaagtgacttacccaatcctgacacgctgtcagctgagcttcattgttggagaatcaaatggaaacacagggggaaagatatagagcttccgtccaccatctatgaagccctccacctgcctgacatcaagttttttcctaatgtgtatgcattgctgaaggtcctgtgtattcttcctgtgatgaaggttgagaatgagcggtatgaaaatggacgaaagcgtcttaaagcatatttgaggaacactttgacagaccaaaggtcaagtaacttggctttgcttaacataaattttgatataaaacacgacctggatttaatggtggacacatatattaaactctatacaagtaagtcagagcttcctacagataattccgaaactgtggaaaatacctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

Reviews

Buy PRKRIR-protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) Gene now

Add to cart