RUVBL1-RuvB-like 1 (E. coli) Gene View larger

RUVBL1-RuvB-like 1 (E. coli) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RUVBL1-RuvB-like 1 (E. coli) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RUVBL1-RuvB-like 1 (E. coli) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002993
Product type: DNA & cDNA
Ncbi symbol: RUVBL1
Origin species: Human
Product name: RUVBL1-RuvB-like 1 (E. coli) Gene
Size: 2ug
Accessions: BC002993
Gene id: 8607
Gene description: RuvB-like 1 (E. coli)
Synonyms: ECP-54; ECP54; INO80H; NMP 238; NMP238; PONTIN; Pontin52; RVB1; TIH1; TIP49; TIP49A; ruvB-like 1; 49 kDa TATA box-binding protein-interacting protein; 49 kDa TBP-interacting protein; 54 kDa erythrocyte cytosolic protein; INO80 complex subunit H; RuvB (E coli homolog)-like 1; RuvB-like AAA ATPase; TAP54-alpha; TATA binding protein interacting protein 49 kDa; TIP60-associated protein 54-alpha; nuclear matrix protein 238; pontin 52; RuvB like AAA ATPase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagattgaggaggtgaagagcactacgaagacgcagcgcatcgcctcccacagccacgtgaaagggctggggctggacgagagcggcttggccaagcaggcggcctcagggcttgtgggccaggagaacgcgcgagaggcatgtggcgtcatagtagaattaatcaaaagcaagaaaatggctggaagagctgtcttgttggcaggacctcctggaactggcaagacagctctggctctggctattgctcaggagctgggtagtaaggtccccttctgcccaatggtggggagtgaagtttactcaactgagatcaagaagacagaggtgctgatggagaacttccgcagggccattgggctgcgaataaaggagaccaaggaagtttatgaaggtgaagtcacagagctaactccgtgtgagacagagaatcccatgggaggatatggcaaaaccattagccatgtgatcataggactcaaaacagccaaaggaaccaaacagttgaaactggaccccagcatttttgaaagtttgcagaaagagcgagtagaagctggagatgtgatttacattgaagccaacagtggggccgtgaagaggcagggcaggtgtgatacctatgccacagaattcgaccttgaagctgaagagtatgtccccttgccaaaaggggatgtgcacaaaaagaaagaaatcatccaagatgtgaccttgcatgacttggatgtggctaatgcgcggccccaggggggacaagatatcctgtccatgatgggccagctaatgaagccaaagaagacagaaatcacagacaaacttcgaggggagattaataaggtggtgaacaagtacatcgaccagggcattgctgagctggtcccgggtgtgctgtttgttgatgaggtccacatgctggacattgagtgcttcacctacctgcaccgcgccctggagtcttctatcgctcccatcgtcatctttgcatccaaccgaggcaactgtgtcatcagaggcactgaggacatcacatcccctcacggcatccctcttgaccttctggaccgagtgatgataatccggaccatgctgtatactccacaggaaatgaaacagatcattaaaatccgtgcccagacggaaggaatcaacatcagtgaggaggcactgaaccacctgggggagattggcaccaagaccacactgaggtactcagtgcagctgctgaccccggccaacttgcttgctaaaatcaacgggaaggacagcattgagaaagagcatgtcgaagagatcagtgaacttttctatgatgccaagtcctccgccaaaatcctggctgaccagcaggataagtacatgaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RuvB-like 2 (E. coli)
- Kruppel-like factor 10
- GATA binding protein 2
- zinc finger protein 71

Buy RUVBL1-RuvB-like 1 (E. coli) Gene now

Add to cart