CALR-calreticulin Gene View larger

CALR-calreticulin Gene

PTXBC002500

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CALR-calreticulin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CALR-calreticulin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002500
Product type: DNA & cDNA
Ncbi symbol: CALR
Origin species: Human
Product name: CALR-calreticulin Gene
Size: 2ug
Accessions: BC002500
Gene id: 811
Gene description: calreticulin
Synonyms: CRT; HEL-S-99n; SSA; cC1qR; CRP55; ERp60; HACBP; Sicca syndrome antigen A (autoantigen Ro; calreticulin); calregulin; endoplasmic reticulum resident protein 60; epididymis secretory sperm binding protein Li 99n; grp60
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgctatccgtgccgctgctgctcggcctcctcggcctggccgtcgccgagcctgccgtctacttcaaggagcagtttctggacggagacgggtggacttcccgctggatcgaatccaaacacaagtcagattttggcaaattcgttctcagttccggcaagttctacggtgacgaggagaaagataaaggtttgcagacaagccaggatgcacgcttttatgctctgtcggccagtttcgagcctttcagcaacaaaggccagacgctggtggtgcagttcacggtgaaacatgagcagaacatcgactgtgggggcggctatgtgaagctgtttcctaatagtttggaccagacagacatgcacggagactcagaatacaacatcatgtttggtcccgacatctgtggccctggcaccaagaaggttcatgtcatcttcaactacaagggcaagaacgtgctgatcaacaaggacatccgttgcaaggatgatgagtttacacacctgtacacactgattgtgcggccagacaacacctatgaggtgaagattgacaacagccaggtggagtccggctccttggaagacgattgggacttcctgccacccaagaagataaaggatcctgatgcttcaaaaccggaagactgggatgagcgggccaagatcgatgatcccacagactccaagcctgaggactgggacaagcccgagcatatccctgaccctgatgctaagaagcccgaggactgggatgaagagatggacggagagtgggaacccccagtgattcagaaccctgagtacaagggtgagtggaagccccggcagatcgacaacccagattacaagggcacttggatccacccagaaattgacaaccccgagtattctcccgatcccagtatctatgcctatgataactttggcgtgctgggcctggacctctggcaggtcaagtctggcaccatctttgacaacttcctcatcaccaacgatgaggcatacgctgaggagtttggcaacgagacgtggggcgtaacaaaggcagcagagaaacaaatgaaggacaaacaggacgaggagcagaggcttaaggaggaggaagaagacaagaaacgcaaagaggaggaggaggcagaggacaaggaggatgatgaggacaaagatgaggatgaggaggatgaggaggacaaggaggaagatgaggaggaagatgtccccggccaggccaaggacgagctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - paired box 6
- flotillin 1
- KIAA0652
- KIAA0391

Buy CALR-calreticulin Gene now

Add to cart