CCNH-cyclin H Gene View larger

CCNH-cyclin H Gene

PTXBC016705

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCNH-cyclin H Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCNH-cyclin H Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016705
Product type: DNA & cDNA
Ncbi symbol: CCNH
Origin species: Human
Product name: CCNH-cyclin H Gene
Size: 2ug
Accessions: BC016705
Gene id: 902
Gene description: cyclin H
Synonyms: CAK; CycH; p34; p37; cyclin-H; CAK complex subunit; CDK-activating kinase complex subunit; MO15-associated protein; cyclin-dependent kinase-activating kinase complex subunit; cyclin H
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtaccacaacagtagtcagaagcggcactggaccttctccagcgaggagcagctggcaagactgcgggctgacgccaaccgcaaattcagatgcaaagccgtggccaacgggaaggttcttccgaatgatccagtctttcttgagcctcatgaagaaatgacactctgcaaatactatgagaaaaggttattggaattctgttcggtgtttaagccagcaatgccaagatctgttgtgggtacggcttgtatgtatttcaaacgtttttatcttaataactcagtaatggaatatcaccccaggataataatgctcacttgtgcatttttggcctgcaaagtagatgaattcaatgtatctagtcctcagtttgttggaaacctccgggagagtcctcttggacaggagaaggcacttgaacagatactggaatatgaactacttcttatacagcaacttaatttccaccttattgtccacaatccttacagaccatttgagggcttcctcatcgacttaaagacccgctatcccatattggagaatccagagattttgaggaaaacagctgatgactttcttaatagaattgcattgacggatgcttaccttttatacacgccttcccaaattgccctgactgccattttatctagtgcctccagggctggaattactatggaaagttatttatcagagagtctgatgctgaaagagaacagaacttgcctgtcacagttactagatataatgaaaagcatgagaaacttagtaaagaagtatgaaccacccagatctgaagaagttgctgttctgaaacagaagttggagcgatgtcattctgctgagcttgcacttaacgtaatcacgaagaagaggaaaggctatgaagatgatgattacgtctcaaagaaatccaaacatgaggaggaagagtggactgatgacgacctggtagaatctctctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cyclin K
- hemopexin
- leupaxin
- villin 1

Buy CCNH-cyclin H Gene now

Add to cart