STX8-syntaxin 8 Gene View larger

STX8-syntaxin 8 Gene

PTXBC009713

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STX8-syntaxin 8 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about STX8-syntaxin 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009713
Product type: DNA & cDNA
Ncbi symbol: STX8
Origin species: Human
Product name: STX8-syntaxin 8 Gene
Size: 2ug
Accessions: BC009713
Gene id: 9482
Gene description: syntaxin 8
Synonyms: CARB; syntaxin-8; CIP-1-associated regulator of cyclin B; syntaxin 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaccggacccctggttctccacatacgattctacttgtcaaattgcccaagaaattgctgagaaaattcaacaacgaaatcaatatgaacgaaaaggtgaaaaggcaccaaagcttaccgtgacaatcagagctttgttgcagaacctgaaggaaaagatcgcccttttgaaggacttattgctaagagctgtgtcaacacatcagataacacagcttgaaggggaccgaagacagaacctcttggatgatcttgtaactcgagagagactacttctggcatcctttaagaatgagggtgccgaaccagatctaatcaggtccagcctgatgagtgaagaggctaagcgaggagcacccaacccttggctctttgaggagccagaggagaccagaggcttgggttttgatgaaatccggcaacagcagcagaaaattatccaagaacaggatgcaggccttgatgccctttcctctatcataagtcgccaaaaacaaatggggcaggaaattgggaatgaattggatgaacaaaatgagataattgacgaccttgccaacctagtggagaacacagatgaaaaacttcgcaatgaaaccaggcgggtaaacatggtggacagaaagtcagcctcttgtgggatgatcatggtgattttactgctgcttgtggctatcgtggttgttgcagtctggccgaccaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - surfeit 1
- syntaxin 5
- syndecan 3
- septin 10

Buy STX8-syntaxin 8 Gene now

Add to cart