Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SSR3-signal sequence receptor, gamma (translocon-associated protein gamma) Gene
PTXBC017203
New product
Data sheet of SSR3-signal sequence receptor, gamma (translocon-associated protein gamma) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SSR3-signal sequence receptor, gamma (translocon-associated protein gamma) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017203 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SSR3 |
| Origin species: | Human |
| Product name: | SSR3-signal sequence receptor, gamma (translocon-associated protein gamma) Gene |
| Size: | 2ug |
| Accessions: | BC017203 |
| Gene id: | 6747 |
| Gene description: | signal sequence receptor, gamma (translocon-associated protein gamma) |
| Synonyms: | TRAPG; translocon-associated protein subunit gamma; SSR gamma; TRAP-complex gamma subunit; TRAP-gamma; signal sequence receptor subunit gamma; signal sequence receptor, gamma (translocon-associated protein gamma); translocon-associated protein gamma subunit; signal sequence receptor subunit 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcctaaaggcagctccaaacagcagtctgaggaggacctgctcctgcaggatttcagccgcaatctctcggccaagtcctccgcgctcttcttcggaaacgcgttcatcgtgtctgccatccccatctggttatactggcgaatatggcatatggatcttattcagtctgctgttttgtatagtgtgatgaccctagtaagcacatatttggtagcctttgcatacaagaatgtgaaatttgttctcaagcacaaagtagcacagaagagggaggatgctgtttccaaagaagtgactcgaaaactttctgaagctgataatagaaagatgtctcggaaggagaaagatgaaagaatcttgtggaagaagaatgaagttgctgattatgaagctacaacattttccatcttctataacaacactctgttcctggtcgtggtcattgttgcttccttcttcatattgaagaacttcaaccccacagtgaactacatattgtccataagtgcttcatcaggactcatcgccctcctgtctactggctccaaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - sorting and assembly machinery component 50 homolog (S. cerevisiae) - sorting and assembly machinery component 50 homolog (S. cerevisiae) - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F2 - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1 |