> >>HIST1H1T-histone cluster 1, H1t Gene
HIST1H1T-histone cluster 1, H1t Gene View larger

HIST1H1T-histone cluster 1, H1t Gene

PTXBC130350

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of HIST1H1T-histone cluster 1, H1t Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HIST1H1T-histone cluster 1, H1t Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC130350
Product type: DNA & cDNA
Ncbi symbol: HIST1H1T
Origin species: Human
Product name: HIST1H1T-histone cluster 1, H1t Gene
Size: 2ug
Accessions: BC130350
Gene id: 3010
Gene description: histone cluster 1, H1t
Synonyms: H1.6; H1FT; dJ221C16.2; histone H1t; H1 histone family, member T (testis-specific); histone 1, H1t; histone cluster 1, H1t; testicular H1 histone; histone cluster 1 H1 family member t
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgaaaccgtgcctgcagcttctgccagtgctggtctagccgctatggagaaacttccaaccaagaagcgagggaggaagccggctggcttgataagtgcaagtcgcaaagtgccgaacctctctgtgtccaagttgatcaccgaggccctttcagtgtcacaggaacgagtaggtatgtctttggttgcgctcaagaaggcattggccgctgctggctacgacgtagagaagaataacagccgcatcaaactgtccctcaagagcttagtgaacaagggaatcctggtgcaaaccaggggtactggtgcttccggttcctttaagcttagtaagaaggtgattcctaaatctaccagaagcaaggctaaaaagtcagtttctgccaagaccaagaagctggttttatccagggactccaagtcaccaaagactgctaaaaccaataagagagccaagaagccgagagcgacaactcctaaaactgttaggagcgggagaaaggctaaaggagccaagggtaagcaaaagcagaagagcccagtgaaggcaagggcttcgaagtcaaaattgacccaacatcatgaagttaatgttagaaaggccacatctaagaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical LOC401260
- hypothetical LOC440200
- transmembrane protein 44
- dynein heavy chain-like 1

Reviews

Buy HIST1H1T-histone cluster 1, H1t Gene now

Add to cart