Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SCGB1D4-secretoglobin, family 1D, member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SCGB1D4-secretoglobin, family 1D, member 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130639 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SCGB1D4 |
| Origin species: | Human |
| Product name: | SCGB1D4-secretoglobin, family 1D, member 4 Gene |
| Size: | 2ug |
| Accessions: | BC130639 |
| Gene id: | 404552 |
| Gene description: | secretoglobin, family 1D, member 4 |
| Synonyms: | IIS; secretoglobin family 1D member 4; IFN-gamma inducible SCGB (IIS); IFN-gamma-inducible secretoglobin |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggctgtcagtgtgtctcctgatggtctcgctggccctttgctgctaccaggcccatgctcttgtctgcccagctgttgcttctgagatcacagtcttcttattcttaagtgacgctgcggtaaacctccaagttgccaaacttaatccacctccagaagctcttgcagccaagttggaagtgaagcactgcaccgatcagatatcttttaagaaacgactctcattgaaaaagtcctggtggaaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - interleukin 29 (interferon, lambda 1) - mitochondrial ribosomal protein L45 - chromosome 2 open reading frame 60 - chromosome 1 open reading frame 38 |