No products
Prices are tax excluded
PTXBC141805
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC141805 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM101A |
| Origin species: | Human |
| Product name: | FAM101A-family with sequence similarity 101, member A Gene |
| Size: | 2ug |
| Accessions: | BC141805 |
| Gene id: | 144347 |
| Gene description: | family with sequence similarity 101, member A |
| Synonyms: | protein FAM101A; filamin-interacting protein FAM101A; FAM101A; CFM2; family with sequence similarity 101, member A; refilinA; regulator of filamin protein A; refilin A |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggccccggatgctgccagtgttctttggggagagcatcaaggtgaacccggaacccacgcatgagatccgctgcaactctgaggtcaagtacgcctcggagaagcatttccaggacaaggtcttctatgcgcctgtacccaccgtcacggcctacagcgagaccatcgtggcagcacccaactgcacgtggcgcaactaccgcagccagctgaccctggagccacgcccgcgcgccctgcgcttccgcagcaccaccatcatcttccccaagcatgccaggagcactttccggaccaccctgcactgcagcctgggccggcccagccgctggttcaccgccagcgtgcagctgcagctttgccaggaccctgcccccagcctcctgggccctgccacgctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - Williams-Beuren syndrome chromosome region 23 - family with sequence similarity 133, member A - TGFB-induced factor homeobox 2-like, X-linked - caspase 5, apoptosis-related cysteine peptidase |