PTXBC010847
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC010847 |
Product type: | DNA & cDNA |
Ncbi symbol: | C19orf66 |
Origin species: | Human |
Product name: | C19orf66-chromosome 19 open reading frame 66 Gene |
Size: | 2ug |
Accessions: | BC010847 |
Gene id: | 55337 |
Gene description: | chromosome 19 open reading frame 66 |
Synonyms: | UPF0515 protein C19orf66; RyDEN; repressor of yield of DENV protein; Repressor of yield of Dengue virus; repressor of yield of DENV; chromosome 19 open reading frame 66 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgtctcaggaaggtgtggagctggagaagagcgtccggcgcctccgggagaagtttcatgggaaggtatcctccaagaaggcgggggctctgatgaggaaattcggcagcgaccacacgggagtggggcgctccatcgtgtacggggtaaagcaaaaagatggccaagaactaagtaacgatctggatgcccaggatccaccagaagatatgaagcaggaccgggacattcaggcagtggcgacctccctcctgccactgacagaagccaacctacgcatgtttcaacgtgcccaggacgaccttatccctgctgtggaccggcagtttgcctgctcctcctgcgaccacgtctggtggcgccgcgtgccccagcggaaggaggtatcccggtgccggaaatgccggaagcgctacgagccagtgccagctgacaagatgtggggcctggctgagttccactgcccgaagtgtcggcacaacttccggtga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - chromosome 1 open reading frame 104 - hypothetical locus DKFZp434K191 - hypothetical locus DKFZp434K191 - chromosome 17 open reading frame 58 |