> >>SHISA3-shisa homolog 3 (Xenopus laevis) Gene
SHISA3-shisa homolog 3 (Xenopus laevis) Gene View larger

SHISA3-shisa homolog 3 (Xenopus laevis) Gene

PTXBC127690

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of SHISA3-shisa homolog 3 (Xenopus laevis) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SHISA3-shisa homolog 3 (Xenopus laevis) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC127690
Product type: DNA & cDNA
Ncbi symbol: SHISA3
Origin species: Human
Product name: SHISA3-shisa homolog 3 (Xenopus laevis) Gene
Size: 2ug
Accessions: BC127690
Gene id: 152573
Gene description: shisa homolog 3 (Xenopus laevis)
Synonyms: hShisa3; protein shisa-3 homolog; shisa homolog 3; shisa family member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagggcactgctggcgctttgccttctccttggctgtctgcgctggggcccggcgggcgcccagcagtccggagagtactgccacggctgggtggacgtgcagggcaactaccacgagggcttccagtgcccagaggacttcgacacgctggacgctaccatctgctgcggctcctgcgcgctccgctactgttgcgccgcggccgacgccaggctggagcagggcggctgcaccaacgaccgccgcgaactggagcacccaggcatcactgcgcagcctgtctacgtcccctttctcatcgtcggctccatcttcattgcgttcatcatcctgggctctgtagtggctatttattgttgcacctgtttgagacccaaggagccctcgcagcagccaatccgcttctcactccgcagctatcagacagagaccctgcccatgatcctgacctccaccagccccagggcaccctcccggcagtccagcacagccacgagctccagctccacaggcggctccatccgcaggttctcctttgccagggctgagccgggctgcctggtgccctcaccgcccccgccatacaccaccagccactcaatccacctggctcagccatctggtttcctggtgtcaccccagtatttcgcttaccccctccagcaggagcccccactgcctgggaagagctgtccagacttcagttccagttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 25
- keratin associated protein 4-2
- keratin associated protein 8-1
- ornithine decarboxylase antizyme 1

Reviews

Buy SHISA3-shisa homolog 3 (Xenopus laevis) Gene now

Add to cart