Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NCR3-natural cytotoxicity triggering receptor 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NCR3-natural cytotoxicity triggering receptor 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018752 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NCR3 |
| Origin species: | Human |
| Product name: | NCR3-natural cytotoxicity triggering receptor 3 Gene |
| Size: | 2ug |
| Accessions: | BC018752 |
| Gene id: | 259197 |
| Gene description: | natural cytotoxicity triggering receptor 3 |
| Synonyms: | 1C7; CD337; LY117; MALS; NKp30; natural cytotoxicity triggering receptor 3; NK-p30; activating NK-A1 receptor; activating natural killer receptor p30; lymphocyte antigen 117; natural killer cell p30-related protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcctggatgctgttgctcatcttgatcatggtccatccaggatcctgtgctctctgggtgtcccagccccctgagattcgtaccctggaaggatcctctgccttcctgccctgctccttcaatgccagccaagggagactggccattggctccgtcacgtggttccgagatgaggtggttccagggaaggaggtgaggaatggaaccccagagttcaggggccgcctggccccacttgcttcttcccgtttcctccatgaccaccaggctgagctgcacatccgggacgtgcgaggccatgacgccagcatctacgtgtgcagagtggaggtgctgggccttggtgtcgggacagggaatgggactcggctggtggtggagaaagaacatcctcagctaggggctggtacagtcctcctccttcgggctggattctatgctgtcagctttctctctgtggccgtgggcagcaccgtctattaccagggcaaatatgccaaatctactctctccggattcccccaactctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - membrane-associated ring finger (C3HC4) 2 - bone gamma-carboxyglutamate (gla) protein - similar to RIKEN cDNA C630028N24 gene - LIM homeobox transcription factor 1, beta |