Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RHD-Rh blood group, D antigen Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RHD-Rh blood group, D antigen Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC139922 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RHD |
| Origin species: | Human |
| Product name: | RHD-Rh blood group, D antigen Gene |
| Size: | 2ug |
| Accessions: | BC139922 |
| Gene id: | 6007 |
| Gene description: | Rh blood group, D antigen |
| Synonyms: | blood group protein RHD; RhD polypeptide; RhD blood group antigen; CD240D; DIIIc; RH30; RHCED; RHDVA(TT); RHDel; RHPII; RHXIII; Rh4; RhDCw; RhII; RhK562-II; RhPI; blood group Rh(D) polypeptide; D antigen (DCS); RH polypeptide 2; Rh blood group CcEe antigen; Rh blood group antigen Evans; Rh blood group, D anitgen; Rhesus blood group D antigen allele DIII type 7; Rhesus system D polypeptide; blood group antigen D; rhesus D antigen; truncated Rh blood group D antigen; truncated rhesus D; truncated rhesus blood group D antigen; Rh blood group D antigen |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagctctaagtacccgcggtctgtccggcgctgcctgcccctctgggccctaacactggaagcagctctcattctcctcttctatttttttacccactatgacgcttccttagaggatcaaaaggggctcgtggcatcctatcaagttggccaagatctgaccgtgatggcggccattggcttgggcttcctcacctcgagtttccggagacacagctggagcagtgtggccttcaacctcttcatgctggcgcttggtgtgcagtgggcaatcctgctggacggcttcctgagccagttcccttctgggaaggtggtcatcacactgttcagtattcggctggccaccatgagtgctttgtcggtgctgatctcagtggatgctgtcttggggaaggtcaacttggcgcagttggtggtgatggtgctggtggaggtgacagctttaggcaacctgaggatggtcatcagtaatatcttcaacacagactaccacatgaacatgatgcacatctacgtgttcgcagcctattttgggctgtctgtggcctggtgcctgccaaagcctctacccgagggaacggaggataaagatcagacagcaacgatacccagtttgtctgccatgctgggcgccctcttcttgtggatgttctggccaagtttcaactctgctctgctgagaagtccaatcgaaaggaagaatgccgtgttcaacacctactatgctgtagcagtcagcgtggtgacagccatctcagggtcatccttggctcacccccaagggaagatcagcaagacttatgtgcacagtgcggtgttggcaggaggcgtggctgtgggtacctcgtgtcacctgatcccttctccgtggcttgccatggtgctgggtcttgtggctgggctgatctccgtcgggggagccaagtacctgccgtttcctcatttggctgttggattttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - POU class 6 homeobox 1 - OTU domain containing 3 - synaptotagmin XIV-like - POU class 5 homeobox 1 |