Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PIAS4-protein inhibitor of activated STAT, 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PIAS4-protein inhibitor of activated STAT, 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004389 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PIAS4 |
| Origin species: | Human |
| Product name: | PIAS4-protein inhibitor of activated STAT, 4 Gene |
| Size: | 2ug |
| Accessions: | BC004389 |
| Gene id: | 51588 |
| Gene description: | protein inhibitor of activated STAT, 4 |
| Synonyms: | E3 SUMO-protein ligase PIAS4; PIAS-gamma; PIASY; Piasg; ZMIZ6; protein inhibitor of activated STAT protein 4; protein inhibitor of activated STAT protein PIASy; protein inhibitor of activated STAT protein gamma; zinc finger, MIZ-type containing 6; protein inhibitor of activated STAT 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtacctgtcctcggccaccaaccgcatcactgtcacctgggggaactacggcaagagctactcggtggccctgtacctggtgcggcagctgacctcatcggagctgctgcagaggctgaagaccattggggtaaagcacccggagctgtgcaaggcactggtcaaggagaagctgcgccttgatcctgacagcgagatcgccaccaccggtgtgcgggtgtccctcatctgtccgctggtgaagatgcggctctccgtgccctgccgggcagagacctgcgcccacctgcagtgcttcgacgccgtcttctacctgcagatgaacgagaagaagcccacctggatgtgccccgtgtgcgacaagccagccccctacgaccagctcatcatcgacgggctcctctcgaagatcctgagcgagtgtgaggacgccgacgagatcgagtacctggtggacggctcgtggtgcccgatccgcgccgaaaaggagcgcagctgcagcccgcagggcgccatcctcgtgctgggcccctcggacgccaatgggctcctgcccgcccccagcgtcaacgggagcggtgccctgggcagcacgggtggcggcggcccggtgggcagcatggagaatgggaagccgggcgccgatgtggtggacctcacgctggacagctcatcgtcctcggaggatgaggaggaggaggaagaggaggaggaagacgaggacgaagaggggccccggcccaagcgccgctgccccttccagaagggcctggtgccggcctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 6 open reading frame 185 - nuclear receptor interacting protein 2 - zinc finger, CCHC domain containing 9 - chromosome 1 open reading frame 226 |