Cart 3 Product Products 317,33 € (empty)
-
-
1 x SCLT1-sodi...113,40 € -
No products
To be determined Shipping
317,33 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 317,33 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 317,33 €
Data sheet of GPR68-G protein-coupled receptor 68 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPR68-G protein-coupled receptor 68 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC128536 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPR68 |
| Origin species: | Human |
| Product name: | GPR68-G protein-coupled receptor 68 Gene |
| Size: | 2ug |
| Accessions: | BC128536 |
| Gene id: | 8111 |
| Gene description: | G protein-coupled receptor 68 |
| Synonyms: | AI2A6; GPR12A; OGR1; ovarian cancer G-protein coupled receptor 1; ovarian cancer G protein-coupled receptor, 1; sphingosylphosphorylcholine receptor; G protein-coupled receptor 68 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggagtgtggccccttcaggcccaaagatggggaacatcactgcagacaactcctcgatgagctgtaccatcgaccataccatccaccagacgctggccccggtggtctatgttaccgtgctggtggtgggcttcccggccaactgcctgtccctctacttcggctacctgcagatcaaggcccggaacgagctgggcgtgtacctgtgcaacctgacggtggccgacctcttctacatctgctcgctgcccttctggctgcagtacgtgctgcagcacgacaactggtctcacggcgacctgtcctgccaggtgtgcggcatcctcctgtacgagaacatctacatcagcgtgggcttcctctgctgcatctccgtggaccgctacctggctgtggcccatcccttccgcttccaccagttccggaccctgaaggcggccgtcggcgtcagcgtggtcatctgggccaaggagctgctgaccagcatctacttcctgatgcacgaggaggtcatcgaggacgagaaccagcaccgcgtgtgctttgagcactaccccatccaggcatggcagcgcgccatcaactactaccgcttcctggtgggcttcctcttccccatctgcctgctgctggcgtcctaccagggcatcctgcgcgccgtgcgccggagccacggcacccagaagagccgcaaggaccagatccagcggctggtgctcagcaccgtggtcatcttcctggcctgcttcctgccctaccacgtgttgctgctggtgcgcagcgtctgggaggccagctgcgacttcgccaagggcgttttcaacgcctaccacttctccctcctgctcaccagcttcaactgcgtcgccgaccccgtgctctactgcttcgtcagcgagaccacccaccgggacctggcccgcctccgcggggcctgcctggccttcctcacctgctccaggaccggccgggccagggaggcctacccgctgggtgcccccgaggcctccgggaaaagcggggcccagggtgaggagcccataatctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - spermatogenesis associated 1 - transmembrane protein 120B - TNFAIP3 interacting protein 3 - transmembrane protein 200B |