Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RHCE-Rh blood group, CcEe antigens Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RHCE-Rh blood group, CcEe antigens Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC139905 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RHCE |
| Origin species: | Human |
| Product name: | RHCE-Rh blood group, CcEe antigens Gene |
| Size: | 2ug |
| Accessions: | BC139905 |
| Gene id: | 6006 |
| Gene description: | Rh blood group, CcEe antigens |
| Synonyms: | truncated RHCE; blood group RhCE polypeptide; Rhesus blood group Rhce antigen; RhCE blood group antigens; RHCE blood group variant Crawford antigen Rh43; CD240CE; RH30A; RHC; RHE; RHIXB; RHPI; Rh4; RhIVb(J); RhVI; RhVIII; blood group Rh(CE) polypeptide; (C)ces type 1 Rhesus blood group D antigen; Rh blood group C antigen; Rh blood group CcEe antigen; Rh blood group antigen Evans; Rh blood group protein; Rh polypeptide I; Rhesus blood group CE protein; Rhesus blood group E antigen; Rhesus system C and E polypeptides; blood group RhCcEe antigen; rh polypeptide 1; rhesus C/E antigens; rhesus blood group antigen, RhC antigen; rhesus blood group little e antigen; silenced Rh blood group CcEe antigen; truncated RhCcEe antigen; Rh blood group CcEe antigens |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagctctaagtacccgcggtctgtccggcgctgcctgcccctctgcgccctaacactggaagcagctctcattctcctcttctatttttttacccactatgacgcttccttagaggatcaaaaggggctcgtggcatcctatcaagttggccaagatctgaccgtgatggcggccattggcttgggcttcctcacctcgagtttccggagacacagctggagcagtgtggccttcaacctcttcatgctggcgcttggtgtgcagtgggcaatcctgctggacggcttcctgagccagttcccttctgggaaggtggtcatcacactgttcagtattcggctggccaccatgagtgctatgtcggtgctgatctcagcgggtgctgtcttggggaaggtcaacttggcgcagttggtggtgatggtgctggtggaggtgacagctttaggcaccctgaggatggtcatcagtaatatcttcaacacagactaccacatgaacctgaggcacttctacgtgttcgcagcctattttgggctgactgtggcctggtgcctgccaaagcctctacccaagggaacggaggataatgatcagagagcaacgatacccagtttgtctgccatgctgggcgccctcttcttgtggatgttctggccaagtgtcaactctgctctgctgagaagtccaatccaaaggaagaatgccatgttcaacacctactatgctctagcagtcagtgtggtgacagccatctcagggtcatccttggctcacccccaaaggaagatcagcatgacttatgtgcacagtgcggtgttggcaggaggcgtggctgtgggtacctcgtgtcacctgatcccttctccgtggcttgccatggtgctgggtcttgtggctgggctgatctccatcgggggagccaagtgcctgccggtgtgttgtaaccgagtgctggggattcaccacatctccgtcatgcactccatcttcagcttgctgggtctgcttggagagatcacctacattgtgctgctggtgcttcatactgtctggaacggcaatggcatgattggcttccaggtcctcctcagcattggggaactcagcttggccatcgtgatagctctcacgtctggtctcctgacaggtttgctcctaaatctcaaaatatggaaagcacctcatgtggctaaatattttgatgaccaagttttctggaagtttcctcatttggctgttggattttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - acyl-Coenzyme A oxidase-like - pyrophosphatase (inorganic) 1 - canopy 4 homolog (zebrafish) - immunoglobulin kappa constant |