Cart 3 Product Products 384,28 € (empty)
-
1 x GPR177-G...121,50 € -
1 x DUSP21-dua...113,40 € -
No products
To be determined Shipping
384,28 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 384,28 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 384,28 €
Data sheet of TMEM201-transmembrane protein 201 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM201-transmembrane protein 201 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC121187 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM201 |
| Origin species: | Human |
| Product name: | TMEM201-transmembrane protein 201 Gene |
| Size: | 2ug |
| Accessions: | BC121187 |
| Gene id: | 199953 |
| Gene description: | transmembrane protein 201 |
| Synonyms: | Ima1; NET5; SAMP1; transmembrane protein 201; RP13-15M17.2; spindle-associated membrane protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagggagtgagcgcgctgctggcccgctgccccacggccggcctggccggcggcctgggggtcacggcgtgcgccgcggccggcgtgttgctctaccggatcgcgcggaggatgaagccaacgcacacgatggtcaactgctggttctgcaaccaggatacgctggtgccctatgggaaccgcaactgctgggactgtccccactgcgagcagtacaacggcttccaggagaacggcgactacaacaagccgatccccgcccagtacttggagcacctgaaccacgtggtgagcagcgcgcccagcctgcgcgacccttcgcagccgcagcagtgggtgagcagccaagtcctgctgtgcaagaggtgcaaccaccaccagaccaccaagatcaagcagctggccgccttcgctccccgcgaggagggcaggtatgacgaggaggtcgaggtgtaccggcatcacctggagcagatgtacaagctgtgccggccgtgccaagcggctgtggagtactacatcaagcaccagaaccgccagctgcgcgccctgttgctcagccaccagttcaagcgccgggaggccgaccagacccacgcacagaacttctcctccgccgtgaagtccccggtccaggtcatcctgctccgtgccctcgccttcctggcctgcgccttcctactgaccaccgcgctgtatggggccagcggacacttcgccccaggcaccactgtgcccctggccctgccacctggtggcaatggctcagccacacctgacaatggcaccacccctggggccgagggctggcggcagttgctgggcctactccccgagcacatggcggagaagctgtgtgaggcctgggcctttgggcagagccaccagacgggcgtcgtggcactgggcctactcacctgcctgctggcaatgctgctggctggccgcatcaggctccggaggatcgatgccttctgcacctgcctgtgggccctgctgctggggctgcacctggctgagcagcacctgcaggccgcctcgcctagctggctagacacgctcaagttcagcaccacatctttgtgctgcctggttggcttcacggcggctgtggccacaaggaaggcaacgggcccacggaggttccggccccgaaggtcagagaagcagccatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 131 - exostoses (multiple)-like 2 - actin, gamma pseudogene - GRB2-related adaptor protein |