RPS6KA3-ribosomal protein S6 kinase, 90kDa, polypeptide 3 Gene View larger

RPS6KA3-ribosomal protein S6 kinase, 90kDa, polypeptide 3 Gene


New product

Data sheet of RPS6KA3-ribosomal protein S6 kinase, 90kDa, polypeptide 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPS6KA3-ribosomal protein S6 kinase, 90kDa, polypeptide 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC096301
Product type: DNA & cDNA
Ncbi symbol: RPS6KA3
Origin species: Human
Product name: RPS6KA3-ribosomal protein S6 kinase, 90kDa, polypeptide 3 Gene
Size: 2ug
Accessions: BC096301
Gene id: 6197
Gene description: ribosomal protein S6 kinase, 90kDa, polypeptide 3
Synonyms: CLS; HU-3; ISPK-1; MAPKAPK1B; MRX19; RSK; RSK2; S6K-alpha3; p90-RSK2; pp90RSK2; ribosomal protein S6 kinase alpha-3; MAP kinase-activated protein kinase 1b; MAPK-activated protein kinase 1b; MAPKAP kinase 1b; MAPKAPK-1b; RSK-2; S6K-alpha-3; insulin-stimulated protein kinase 1; p90-RSK 3; ribosomal S6 kinase 2; ribosomal protein S6 kinase, 90kDa, polypeptide 3; ribosomal protein S6 kinase A3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgctggcgcagctggcggacccgtggcagaagatggctgtggagagcccgtccgacagcgctgagaatggacagcaaattatggatgaacctatgggagaggaggagattaacccacaaactgaagaagtcagtatcaaagaaattgcaatcacacatcatgtaaaggaaggacatgaaaaggcagatccttcccagtttgaacttttaaaagtattagggcagggatcatttggaaaggttttcttagttaaaaaaatctcaggctctgatgctaggcagctttatgccatgaaggtattgaagaaggccacactgaaagttcgagaccgagttcggacaaaaatggaacgtgatatcttggtagaggttaatcatccttttattgtcaagttgcattatgcttttcaaactgaagggaagttgtatcttattttggattttctcaggggaggagatttgtttacacgcttatccaaagaggtgatgttcacagaagaagatgtcaaattctacttggctgaacttgcacttgctttagaccatctacatagcctgggaataatttatagagacttaaaaccagaaaatatacttcttgatgaagaaggtcacatcaagttaacagatttcggcctaagtaaagagtctattgaccatgaaaagaaggcatattctttttgtggaactgtggagtatatggctccagaagtagttaatcgtcgaggtcatactcagagtgctgactggtggtcttttggtgtgttaatgtttgaaatgcttactggtacactccctttccaaggaaaagatcgaaaagaaacaatgactatgattcttaaagccaaacttggaatgccacagtttttgagtcctgaagcgcagagtcttttacgaatgcttttcaagcgaaatcctgcaaacagattaggtgcaggaccagatggagttgaagaaattaaaagacattcatttttctcaacgatagactggaataaactgtatagaagagaaattcatccgccatttaaacctgcaacgggcaggcctgaagatacattctattttgatcctgagtttactgcaaaaactcccaaagattcacctggcattccacctagtgctaatgcacatcagctttttcgggggtttagttttgttgctattacctcagatgatgaaagccaagctatgcagacagttggtgtacattcaattgttcagcagttacacaggaacagtattcagtttactgatggatatgaagtaaaagaagatattggagttggctcctactctgtttgcaagagatgtatacataaagctacaaacatggagtttgcagtgaagattattgataaaagcaagagagacccaacagaagaaattgaaattcttcttcgttatggacagcatccaaacattatcactctaaaggatgtatatgatgatggaaagtatgtgtatgtagtaacagaacttatgaaaggaggtgaattgctggataaaattcttagacaaaaatttttctctgaacgagaggccagtgctgtcctgttcactataactaaaaccgttgaatatcttcacgcacaaggggtggttcatagagacttgaaacctagcaacattctttatgtggatgaatctggtaatccggaatctattcgaatttgtgattttggctttgcaaaacagctgagagcggaaaatggtcttctcatgactccttgttacactgcaaattttgttgcaccagaggttttaaaaagacaaggctatgatgctgcttgtgatatatggagtcttggtgtcctactctatacaatgcttaccggttacactccatttgcaaatggtcctgatgatacaccagaggaaatattggcacgaataggtagcggaaaattctcactcagtggtggttactggaattctgtttcagacacagcaaaggacctggtgtcaaagatgcttcatgtagaccctcatcagagactgactgctgctcttgtgctcagacatccttggatcgtccactgggaccaactgccacaataccaactaaacagacaggatgcaccacatctagtaaagggtgccatggcagctacatattctgctttgaaccgtaatcagtcaccagttttggaaccagtaggccgctctactcttgctcagcggagaggtattaaaaaaatcacctcaacagccctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - roundabout homolog 4, magic roundabout (Drosophila)
- phospholipase C, beta 1 (phosphoinositide-specific)
- proteasome (prosome, macropain) activator subunit 4
- protein tyrosine phosphatase, non-receptor type 23

Buy RPS6KA3-ribosomal protein S6 kinase, 90kDa, polypeptide 3 Gene now

Add to cart