CHRNA4-cholinergic receptor, nicotinic, alpha 4 Gene View larger

CHRNA4-cholinergic receptor, nicotinic, alpha 4 Gene


New product

Data sheet of CHRNA4-cholinergic receptor, nicotinic, alpha 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CHRNA4-cholinergic receptor, nicotinic, alpha 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC096290
Product type: DNA & cDNA
Ncbi symbol: CHRNA4
Origin species: Human
Product name: CHRNA4-cholinergic receptor, nicotinic, alpha 4 Gene
Size: 2ug
Accessions: BC096290
Gene id: 1137
Gene description: cholinergic receptor, nicotinic, alpha 4
Synonyms: BFNC; EBN; EBN1; NACHR; NACHRA4; NACRA4; neuronal acetylcholine receptor subunit alpha-4; cholinergic receptor, nicotinic alpha 4; cholinergic receptor, nicotinic, alpha 4 (neuronal); cholinergic receptor, nicotinic, alpha polypeptide 4; neuronal nicotinic acetylcholine receptor alpha-4 subunit; cholinergic receptor nicotinic alpha 4 subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagctagagggccccggagcgccgcggctgctgccgccgctgctgctacttctggggaccggcctcctgcgcgccagcagccatgtggagacccgggcccacgccgaggagcggctcctgaagaaactcttctccggttacaacaagtggtcccgacccgtggccaacatctcggacgtggtcctcgtccgcttcggcctgtccatcgctcagctcattgacgtggatgagaagaaccagatgatgaccacgaacgtatgggtgaagcaggagtggcacgactacaagctgcgctgggacccagctgactatgagaatgtcacctccatccgcatcccctccgagctcatctggcggccggacatcgtcctctacaacaatgctgacggggacttcgcggtcacccacctgaccaaggcccacctgttccatgacgggcgggtgcagtggactcccccggccatttacaagagctcctgcagcatcgacgtcaccttcttccccttcgaccagcagaactgcaccatgaaattcggctcctggacctacgacaaggccaagatcgacctggtgaacatgcacagccgcgtggaccagctggacttctgggagagtggcgagtgggtcatcgtggacgccgtgggcacctacaacaccaggaagtacgagtgctgcgccgagatctacccggacatcacctatgccttcgtcatccggcggctgccgctcttctacaccatcaacctcatcatcccctgcctgctcatctcctgcctcaccgtgctggtcttctacctgccctccgagtgtggcgagaagatcacgctgtgcatctccgtgctgctgtcgctcaccgtcttcctgctgctcatcaccgagatcatcccgtccacctcactggtcatcccactcatcggcgagtacctgctgttcaccatgatcttcgtcaccctgtccatcgtcatcacggtcttcgtgctcaacgtgcaccaccgctcgccacgcacgcacaccatgcccacctgggtacgcagggtcttcctggacatcgtgccacgcctgctcctcatgaagcggccgtccgtggtcaaggacaattgccggcggctcatcgagtccatgcataagatggccagtgccccgcgcttctggcccgagccagaaggggagccccctgccacgagcggcacccagagcctgcaccctccctcaccgtccttctgcgtccccctggatgtgccggctgagcctgggccttcctgcaagtcaccctccgaccagctccctcctcagcagcccctggaagctgagaaagccagcccccacccctcgcctggaccctgccgcccgccccacggcacccaggcaccagggctggccaaagccaggtccctcagcgtccagcacatgtccagccctggcgaagcggtggaaggcggcgtccggtgccggtctcggagcatccagtactgtgttccccgagacgatgccgcccccgaggcagatggccaggctgccggcgccctggcctctcgcaacacccactcggctgagctcccacccccagaccagccctctccgtgcaaatgcacatgcaagaaggagccctcttcggtgtccccgagtgccacggtcaagacccgcagcaccaaagcaccgcccccgcacctgcccctgtcgccggccctgacccgggcggtggagggcgtccagtacattgcagaccacctgaaggccgaagacacagacttctcggtgaaggaggactggaagtacgtggccatggtcatcgaccgcatcttcctctggatgttcatcatcgtctgcctgctggggacggtgggcctcttcctgccgccctggctggctggcatgatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - peptidylprolyl isomerase G (cyclophilin G)
- F-box and leucine-rich repeat protein 10
- Janus kinase 1 (a protein tyrosine kinase)
- topoisomerase (DNA) II binding protein 1