EPB41-erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) Gene View larger

EPB41-erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) Gene

PTXBC096105

New product

Data sheet of EPB41-erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EPB41-erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC096105
Product type: DNA & cDNA
Ncbi symbol: EPB41
Origin species: Human
Product name: EPB41-erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) Gene
Size: 2ug
Accessions: BC096105
Gene id: 2035
Gene description: erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)
Synonyms: 4.1R; EL1; protein 4.1; EPB4.1; P4.1; band 4.1; elliptocytosis 1, RH-linked; erythrocyte surface protein band 4.1; erythrocyte membrane protein band 4.1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcactgcaaggtttctttgttggatgacacagtttatgaatgtgttgtggagaaacatgctaagggacaagatttgcttaaacgagtatgtgagcatctcaatcttttggaagaagactattttggtctagccatttgggataacgcaacctctaagacatggctggattccgccaaagaaataaaaaagcaggttcgtggtgtcccttggaattttacatttaatgtaaagttttatccacctgacccagcacagttaacagaagacataacaagatattatttatgtcttcagcttcggcaggacatagttgcaggacgtctgccctgttcctttgcaaccttagcattattaggttcttacaccatccagtctgaactgggagactacgacccagaactccatggcgtggattatgttagtgattttaaactggccccgaatcagaccaaggaacttgaagagaaggtcatggaactgcataagtcatacaggtccatgactccagctcaggctgacttggagtttcttgagaatgccaaaaagttgtctatgtatggagttgatcttcataaagcaaaggacttggaaggagtagatatcatcctaggtgtctgctctagtggccttctggtttacaaagataagctgagaattaaccgcttcccttggcccaaagtgctgaagatttcttataaacgtagtagctttttcatcaagattcggcctggagagcaagagcagtatgaaagtaccatcggattcaaacttcccagttaccgagcagctaagaaattatggaaagtctgtgtagaacatcacacgtttttcagattgacatctacagacaccattcccaaaagcaaatttcttgcgctaggatccaaatttcgatacagtggccggactcaagctcagaccaggcaagctagtgctctaattgacaggcctgccccacacttcgagcgtacagcaagtaaacgggcgtcccggagcctcgatggagcagcagctgtcgattcggcagaccgaagtcctcggcccacttctgcacctgccattactcagggtcaggttgcagaaggtggcgtcctagatgcctctgctaaaaaaacagtggtccctaaagcacagaaggaaacagtgaaggctgaagtgaaaaaggaagacgagccacctgagcaagctgagccagagcccacagaagcatggaagaaaaagagagaaagactagatggtgaaaacatttatatcagacatagcaatttaatgttggaggatttagacaagagtcaagaggagatcaaaaaacatcatgccagcatcagtgagctgaaaaagaacttcatggagtctgtaccagaaccacggcctagtgaatgggataaacgcttatccactcactcacccttccgaactcttaacatcaatgggcaaatccccacaggagaaggacctcccctggtgaagacacaaactgtcaccatctcagataatgccaatgctgtgaaaagtgaaatcccaaccaaagacgtccctattgtccacactgagaccaagaccatcacttatgaggctgcccagactgacgacaacagtggagacttggacccaggagtcttgctgacagctcaaactatcacatctgagaccccaagcagcaccaccacaactcaaattaccaagactgtaaaaggtgggatttcagagacacgtattgaaaagagaattgtgatcacaggagatgctgatattgaccatgatcaggtccttgtacaagccatcaaggaggcaaaggagcagcacccagacatgtcagtgaccaaggtggtcgtccaccaggagaccgagattgctgatgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leucine-rich repeats and calponin homology (CH) domain containing 2
- nuclear fragile X mental retardation protein interacting protein 2
- UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5
- ubiquinol-cytochrome c reductase hinge protein

Buy EPB41-erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) Gene now

Add to cart