ACSM1-acyl-CoA synthetase medium-chain family member 1 Gene View larger

ACSM1-acyl-CoA synthetase medium-chain family member 1 Gene

PTXBC125178

New product

Data sheet of ACSM1-acyl-CoA synthetase medium-chain family member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ACSM1-acyl-CoA synthetase medium-chain family member 1 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC125178
Product type: DNA & cDNA
Ncbi symbol: ACSM1
Origin species: Human
Product name: ACSM1-acyl-CoA synthetase medium-chain family member 1 Gene
Size: 2ug
Accessions: BC125178
Gene id: 116285
Gene description: acyl-CoA synthetase medium-chain family member 1
Synonyms: acyl-coenzyme A synthetase ACSM1, mitochondrial; BUCS1; Butyrate--CoA ligase; butyrate--CoA ligase 1; butyryl Coenzyme A synthetase 1; butyryl-coenzyme A synthetase 1; lipoate-activating enzyme; medium-chain acyl-CoA synthetase; middle-chain acyl-CoA synthetase 1; acyl-CoA synthetase medium-chain family member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagtggctaatgaggttccggaccctctggggcatccacaaatccttccacaacatccaccctgccccttcacagctgcgctgccggtctttatcagaatttggagccccaagatggaatgactatgaagtaccggaggaatttaactttgcaagttatgtactggactactgggctcaaaaggagaaggagggcaagagaggtccaaatccagctttttggtgggtgaatggccaaggggatgaagtaaagtggagcttcagagagatgggagacctaacccgccgtgtagccaacgtcttcacacagacctgtggcctacaacagggagaccatctggccttgatgctgcctcgagttcctgagtggtggctggtggctgtgggctgcatgcgaacagggatcatcttcattcctgcgaccatcctgttgaaggccaaagacattctctatcgactacagttgtctaaagccaagggcattgtgaccatagatgcccttgcctcagaggtggactccatagcttctcagtgcccctctctgaaaaccaagctcctggtgtctgatcacagccgtgaagggtggctggacttccgatcgctggttaaatcagcatccccagaacacacctgtgttaagtcaaagaccttggacccaatggtcatcttcttcaccagtgggaccacaggcttccccaagatggcaaaacactcccatgggttggccttacaaccctccttcccaggaagtaggaaattacggagcctgaagacatctgatgtctcctggtgcctgtcggactcaggatggattgtggctaccatttggaccctggtagaaccatggacagcgggttgtacagtctttatccaccatctgccacagtttgacaccaaggtcatcatacagacattgttgaaataccccattaaccacttttggggggtatcatctatatatcgaatgattctgcagcaggatttcaccagcatcaggttccctgccctggagcactgctatactggcggggaggtcgtgttgcccaaggatcaggaggagtggaaaagacggacgggccttctgctctacgagaactatgggcagtcggaaacgggactaatttgtgccacctactggggaatgaagatcaagccgggtttcatggggaaggccactccaccctacgacgtccaggtcattgatgacaagggcagcatcctgccacctaacacagaaggaaacattggcatcagaatcaaacctgtcaggcctgtgagcctcttcatgtgctatgagggtgacccagagaagacagctaaagtggaatgtggggacttctacaacactggggacagaggaaagatggatgaagagggctacatttgtttcctggggaggagtgatgacatcattaatgcctctgggtatcgcatcgggcctgcagaggttgaaagtgctttggtggagcacccagcggtggcggagtcagccgtggtgggcagcccagacccgattcgaggggaggtggtgaaggcctttattgtcctgaccccacagttcctgtcccatgacaaggatcagctgaccaaggaactgcagcagcatgtcaagtcagtgacagccccatacaagtacccaaggaaagtggagtttgtctcagagctgccaaaaaccatcactggcaagattgaacggaaggaacttcggaaaaaggagactggtcagatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - N-acetylated alpha-linked acidic dipeptidase 2
- tumor necrosis factor, alpha-induced protein 3
- acyl-Coenzyme A dehydrogenase family, member 10
- Rap guanine nucleotide exchange factor (GEF) 2

Buy ACSM1-acyl-CoA synthetase medium-chain family member 1 Gene now

Add to cart