Cart 1 Product Products 113,40 € (empty)
-
1 x KLK7-kalli...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
SERPINB10-serpin peptidase inhibitor, clade B (ovalbumin), member 10 Gene
PTXBC096217
New product
Data sheet of SERPINB10-serpin peptidase inhibitor, clade B (ovalbumin), member 10 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SERPINB10-serpin peptidase inhibitor, clade B (ovalbumin), member 10 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC096217 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SERPINB10 |
| Origin species: | Human |
| Product name: | SERPINB10-serpin peptidase inhibitor, clade B (ovalbumin), member 10 Gene |
| Size: | 2ug |
| Accessions: | BC096217 |
| Gene id: | 5273 |
| Gene description: | serpin peptidase inhibitor, clade B (ovalbumin), member 10 |
| Synonyms: | PI-10; PI10; serpin B10; peptidase inhibitor 10; protease inhibitor 10 (ovalbumin type, bomapin); serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 10; serpin peptidase inhibitor, clade B (ovalbumin), member 10; serpin family B member 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggactctctagcaacatcaatcaaccagtttgccctggagttgagcaaaaagctagctgaatctgctcagggtaaaaatatcttcttttcttcctggagcatctcaacttccttgaccatagtgtatttgggcgccaaaggtaccactgcagcccaaatggcccaggtgcttcaatttaacagagaccagggagtcaaatgtgaccctgaaagtgaaaaaaaaaggaaaatggaattcaacttgagcaactcggaagaaatacactctgatttccaaacacttatctcagaaatcctcaagcccaacgatgactacttacttaaaacagccaatgcgatatatggagagaaaacgtatgcatttcacaataaatatttagaagacatgaaaacatattttggtgcagaacctcagcctgttaactttgtggaagcttctgatcaaatcagaaaggacatcaactcttgggttgaaagacagaccgagggtaaaatccagaatctcctgcctgatgactctgtggattccacaaccaggatgattctggtgaacgccctatactttaaaggaatctgggaacatcaattcttagtgcaaaacaccacagaaaagccttttagaataaacgagactacaagcaaaccagtgcaaatgatgtttatgaagaaaaagcttcacatttttcacatagaaaagccaaaagcagtgggccttcaactctactacaaaagccgtgacctcagcctgcttatactactgccagaagacattaatgggctggaacagctggaaaaggccatcacctatgagaagctgaatgagtggaccagtgcagacatgatggagttgtatgaagtgcagctacaccttcccaagttcaagctggaagacagttatgatctcaagtcaaccctgagcagtatggggatgagtgatgccttcagccaaagcaaagctgatttctcaggaatgtcttcagcaagaaacctatttttgtccaatgttttccataaggcttttgtggaaataaatgaacaaggtactgaagctgcagctggcagtgggagtgagataaatatacgaattagagtcccatccattgaattcaatgcaaatcacccattcctcttcttcatcaggcacaataaaaccaacaccattcttttttatggaagattatgctccccctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transcription elongation factor B polypeptide 3B (elongin A2) - calcium channel, voltage-dependent, L type, alpha 1S subunit - egf-like module containing, mucin-like, hormone receptor-like 2 - epidermal growth factor receptor pathway substrate 15-like 1 |