Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PTPRR-protein tyrosine phosphatase, receptor type, R Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PTPRR-protein tyrosine phosphatase, receptor type, R Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC122866 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PTPRR |
| Origin species: | Human |
| Product name: | PTPRR-protein tyrosine phosphatase, receptor type, R Gene |
| Size: | 2ug |
| Accessions: | BC122866 |
| Gene id: | 5801 |
| Gene description: | protein tyrosine phosphatase, receptor type, R |
| Synonyms: | EC-PTP; PCPTP1; PTP-SL; PTPBR7; PTPRQ; receptor-type tyrosine-protein phosphatase R; Ch-1 PTPase; NC-PTPCOM1; R-PTP-R; ch-1PTPase; protein tyrosine phosphatase Cr1PTPase; protein-tyrosine phosphatase NC-PTPCOM1; protein-tyrosine phosphatase PCPTP1; protein tyrosine phosphatase, receptor type R |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgattcttcacagattaaaagaaagatttcagctttccttaagacaagacaaagagaaaaaccaggagatccacctatcgcccatcacattacagccagcactgtccgaggcaaagacagtccacagcatggtccaacctgagcaggccccaaaggtactgaatgttgtcgtggaccctcaaggccgaggtgctcctgagatcaaagctaccaccgctacctctgtttgcccttctcctttcaaaatgaagcccataggacttcaaaagagaagagggtccaacgtatctcttacattggacatgagtagcttggggaacattgaaccctttgtgtctataccaacaccacgggagaaggtagcaatggagtatctgcagtcagccagccgaattctcacaaggtctcagctgagggacgtcgtggcaagttcacatttactccaaagtgaattcatggaaataccaatgaactttgtggatcccaaagaaattgatattccgcgtcatggaactaaaaatcgctataagaccattttaccaaatcccctcagcagagtgtgtttaagaccaaaaaatgtaaccgattcattgagcacctacattaatgctaattatattaggggctacagtggcaaggagaaagccttcattgccacgcagggccccatgatcaacaccgtggatgatttctggcagatggtttggcaggaagacagccctgtgattgttatgatcacaaaactcaaagaaaaaaatgagaaatgtgtgctatactggccggaaaagagagggatatatggaaaagttgaggttctggttatcagtgtaaatgaatgtgataactacaccattcgaaaccttgtcttaaagcaaggaagccacacccaacatgtgaagcattactggtacacctcatggcctgatcacaagactccagacagtgcccagcccctcctacagctcatgctggatgtagaagaagacagacttgcttcccagggccgagggcctgtggttgtccactgcagtgcaggaataggtagaacagggtgttttattgctacatccattggctgtcaacagctgaaagaagaaggagttgtggatgcactaagcattgtctgccagcttcgtatggatagaggtggaatggtgcaaaccagtgagcagtatgaatttgtgcaccatgctctgtgcctgtatgagagcagactttcagcagagactgtccagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - gamma-aminobutyric acid (GABA) receptor, theta - T-cell activation RhoGTPase activating protein - NADPH oxidase, EF-hand calcium binding domain 5 - ubiquitin specific peptidase 4 (proto-oncogene) |