PTXBC109209
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC109209 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | P2RX6 |
| Origin species: | Human |
| Product name: | P2RX6-purinergic receptor P2X, ligand-gated ion channel, 6 Gene |
| Size: | 2ug |
| Accessions: | BC109209 |
| Gene id: | 9127 |
| Gene description: | purinergic receptor P2X, ligand-gated ion channel, 6 |
| Synonyms: | P2RXL1; P2X6; P2XM; P2X purinoceptor 6; ATP receptor; purinergic receptor P2X, ligand gated ion channel, 6; purinergic receptor P2X-like 1, orphan receptor; purinoceptor P2X6; purinoreceptor P2X6; skeletal muscle-expressed P2X; purinergic receptor P2X 6 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggctccccaggggctacgacaggctgggggcttctggattataagacggagaagtgggctctcctcgccaaaaaaggctaccaggagcgggacctggaaccccagttttccatcatcaccaaactcaaaggggtttccgtcactcagatcaaggagcttggaaaccggctgtgggatgtggccgacttcgtgaagccacctcagggagagaacgtgttcttcttggtgaccaacttccttgtgacgccagcccaagttcagggcagatgcccagagcacccgtccgtcccactggctaactgctgggtcgacgaggactgccccgaaggggagggaggcacacacagccacggtgtaaaaacaggccagtgtgtggtgttcaatgggacccacaggacctgtgagatctggagttggtgcccagtggagagtggcgttgtgccctcgaggcccctgctggcccaggcccagaacttcacactgttcatcaaaaacacagtcaccttcagcaagttcaacttctctaagtccaatgccttggagacctgggaccccacctattttaagcactgccgctatgaaccacaattcagcccctactgtcccgtgttccacattggggacctcgtggccaaggctggagggaccttcgaggacctggcgttgctgggtggctctgtaggcatcagagttcactgggattgtgacctggacaccggggactctggctgctggcctcactactccttccagctgcaggagaagagctacaacttcaggacagccactcactggtgggagcaaccgggtgtggaggcccgcaccctgctcaagctctatggaatccgcttcgacatcctcgtcaccgggcaggcagggaagttcgggctcatccccacggccgtcacactgggcaccggggcagcttggctgggcgtggtcacctttttctgtgacctgctactgctgtatgtggatagagaagcccatttctactggaggacaaagtatgaggaggccaaggccccgaaagcaaccgccaactctgtgtggagggagctggcccttgcatcccaagcccgactggccgagtgcctcagacggagctcagcacctgcacccacggccactgctgctgggagtcagacacagacaccaggatggccctgtccaagttctgacacccacttgccaacccattccgggagcctgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - CDK5 regulatory subunit associated protein 1-like 1 - adaptor-related protein complex 4, epsilon 1 subunit - sortilin-related VPS10 domain containing receptor 1 - eukaryotic translation initiation factor 4 gamma, 2 |