Cart 10 Product Products 5 780,40 € (empty)
-
-
-
-
-
1 x RBBP6-reti...113,40 € -
-
-
-
-
No products
To be determined Shipping
5 780,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 10 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 780,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 780,40 €
Data sheet of GJA3-gap junction protein, alpha 3, 46kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GJA3-gap junction protein, alpha 3, 46kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC121137 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GJA3 |
| Origin species: | Human |
| Product name: | GJA3-gap junction protein, alpha 3, 46kDa Gene |
| Size: | 2ug |
| Accessions: | BC121137 |
| Gene id: | 2700 |
| Gene description: | gap junction protein, alpha 3, 46kDa |
| Synonyms: | CTRCT14; CX46; CZP3; gap junction alpha-3 protein; connexin-46; gap junction alpha 3; gap junction protein, alpha 3, 46kDa; gap junction protein alpha 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcgactggagctttctgggaagactcttagaaaatgcacaggagcactccacggtcatcggcaaggtttggctgaccgtgctgttcatcttccgcatcttggtgctgggggccgcggcggaggacgtgtggggcgatgagcagtcagacttcacctgcaacacccagcagccgggctgcgagaacgtctgctacgacagggccttccccatctcccacatccgcttctgggcgctgcagatcatcttcgtgtccacgcccaccctcatctacctgggccacgtgctgcacatcgtgcgcatggaagagaagaagaaagagagggaggaggaggagcagctgaagagagagagccccagccccaaggagccaccgcaggacaatccctcgtcgcgggacgaccgcggcagggtgcgcatggccggggcgctgctgcggacctacgtcttcaacatcatcttcaagacgctgttcgaggtgggcttcatcgccggccagtactttctgtacggcttcgagctgaagccgctctaccgctgcgaccgctggccctgccccaacacggtggactgcttcatctccaggcccacggagaagaccatcttcatcatcttcatgctggcggtggcctgcgcgtccctgctgctcaacatgctggagatctaccacctgggctggaagaagctcaagcagggcgtgaccagccgcctcggcccggacgcctccgaggccccgctggggacagccgatcccccgcccctgccccccagctcccggccgcccgccgttgccatcgggttcccaccctactatgcgcacaccgctgcgcccctgggacaggcccgcgccgtgggctaccccggggccccgccaccagccgcggacttcaaaatgctagccctgaccgaggcgcgcggaaagggccagtccgccaagctctacaacggccaccaccacctgctgatgactgagcagaactgggccaaccaggcggccgagcggcagcccccggcactcaaggcttacccggcagcgtccacgcctgcagcccccagccccgtcggcagcagctccccgccactcgcgcacgaggctgaggcgggcgcggcgcccctgctgctggatgggagcggcagcagtctggaggggagcgccctggcagggacccccgaggaggaggagcaggccgtgaccaccgcggcccagatgcaccagccgcccttgcccctcggagacccaggtcgggccagcaaggccagcagggccagcagcgggcgggccagaccggaggacttggccatctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Rho GTPase activating protein 19 - coiled-coil domain containing 148 - gap junction protein, gamma 1, 45kDa - Rho GTPase activating protein 27 |