Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
P2RY4-pyrimidinergic receptor P2Y, G-protein coupled, 4 Gene
PTXBC096067
New product
Data sheet of P2RY4-pyrimidinergic receptor P2Y, G-protein coupled, 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about P2RY4-pyrimidinergic receptor P2Y, G-protein coupled, 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC096067 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | P2RY4 |
| Origin species: | Human |
| Product name: | P2RY4-pyrimidinergic receptor P2Y, G-protein coupled, 4 Gene |
| Size: | 2ug |
| Accessions: | BC096067 |
| Gene id: | 5030 |
| Gene description: | pyrimidinergic receptor P2Y, G-protein coupled, 4 |
| Synonyms: | NRU; P2P; P2Y4; UNR; P2Y purinoceptor 4; pyrimidinergic receptor P2Y, G-protein coupled, 4; uridine nucleotide receptor; pyrimidinergic receptor P2Y4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccagtacagagtcctccctgttgagatccctaggcctcagcccaggtcctggcagcagtgaggtggagctggactgttggtttgatgaggatttcaagttcatcctgctgcctgtgagctatgcagttgtctttgtgctgggcttgggccttaacgccccaaccctatggctcttcatcttccgcctccgaccctgggatgcaacggccacctacatgttccacctggcattgtcagacaccttgtatgtgctgtcgctgcccaccctcatctactattatgcagcccacaaccactggccctttggcactgagatctgcaagttcgtccgctttcttttctattggaacctctactgcagtgtccttttcctcacctgcatcagcgtgcaccgctacctgggcatctgccacccacttcgggcactacgctggggccgccctcgcctcgcaggccttctctgcctggcagtttggttggtcgtagccggctgcctcgtgcccaacctgttctttgtcacaaccagcaacaaagggaccaccgtcctgtgccatgacaccactcggcctgaagagtttgaccactatgtgcacttcagctcggcggtcatggggctgctctttggcgtgccctgcctggtcactcttgtttgctatggactcatggctcgtcgcctgtatcagcccttgccaggctctgcacagtcgtcttctcgcctccgctctctccgcaccatagctgtggtgctgactgtctttgctgtctgcttcgtgcctttccacatcacccgcaccatttactacctggccaggctgttggaagctgactgccgagtactgaacattgtcaacgtggtctataaagtgactcggcccctggccagtgccaacagctgcctggatcctgtgctctacttgctcactggggacaaatatcgacgtcagctccgtcagctctgtggtggtggcaagccccagccccgcacggctgcctcttccctggcactagtgtccctgcctgaggatagcagctgcaggtgggcggccaccccccaggacagtagctgctctactcctagggcagatagattgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ectonucleoside triphosphate diphosphohydrolase 7 - ubiquitin protein ligase E3 component n-recognin 1 - low density lipoprotein receptor-related protein 6 - mitogen-activated protein kinase kinase kinase 9 |