Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of HNRNPA1-heterogeneous nuclear ribonucleoprotein A1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HNRNPA1-heterogeneous nuclear ribonucleoprotein A1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC121133 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HNRNPA1 |
| Origin species: | Human |
| Product name: | HNRNPA1-heterogeneous nuclear ribonucleoprotein A1 Gene |
| Size: | 2ug |
| Accessions: | BC121133 |
| Gene id: | 3178 |
| Gene description: | heterogeneous nuclear ribonucleoprotein A1 |
| Synonyms: | ALS19; ALS20; HNRPA1; HNRPA1L3; IBMPFD3; UP 1; hnRNP A1; hnRNP-A1; heterogeneous nuclear ribonucleoprotein A1; helix-destabilizing protein; heterogeneous nuclear ribonucleoprotein A1B protein; heterogeneous nuclear ribonucleoprotein B2 protein; heterogeneous nuclear ribonucleoprotein core protein A1; hnRNP core protein A1-like 3; nuclear ribonucleoprotein particle A1 protein; single-strand DNA-binding protein UP1; single-strand RNA-binding protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctaagtcagcgtctccaaaagagcccgaacagctgaggaagctcttcattggagggttgagctttgaaacaactgatgagagcctgaggagccattttgagcaatggggaacgctcacagactgtgtggtaatgagagatccaaacaccaagcgctccaggggctttgggtttgtcacatatgccactgtggaggaggtggatgcagctatgaatgcaaggccacacaaggtggatggaagagttgtggaaccaaagagagctgtctccagagaagattctcaaagaccaggtgcccacttaactgtgaaaaagatatttgttggtggcattaaagaagacactgaagaacatcacctaagagattattttgaacagtatggaaaaattgaagtgattgaaatcatgactgaccgaggcagtggcaagaaaaggggctttgcctttgtaacctttgacgaccatgactccgtggataagattgtcattcagaaataccatactgtgaatggccacaactgtgaagttagaaaagccctgtcaaagcaagagatggctagtgcttcatccagccaaagaggtcgaagtggttctggaaactttggtggtggtcgtggaggtggtttcggtgggaatgacaacttcggtcgtggaggaaacttcagtggtcgtggtggctttggtggcagccgtggtggtggtggatatggtggcagtggggatggctataatggatttggtaatgatggaagcaattttggaggtggtggaagctacaatgattttgggaattacaacaatcagtcttcaaattttggacccatgaagggaggaaattttggaggcagaagctctggcccctatggcggtggaggccaatactttgcaaaaccacaaaaccaaggtggctatggcgtttccagcagcagcagtagctatggcagtggcagaagattttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - v-akt murine thymoma viral oncogene homolog 2 - inositol polyphosphate-5-phosphatase, 40kDa - synovial sarcoma translocation, chromosome 18 - POM121 membrane glycoprotein-like 1 (rat) |