Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
OR1E2-olfactory receptor, family 1, subfamily E, member 2 Gene
PTXBC121105
New product
Data sheet of OR1E2-olfactory receptor, family 1, subfamily E, member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OR1E2-olfactory receptor, family 1, subfamily E, member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC121105 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OR1E2 |
| Origin species: | Human |
| Product name: | OR1E2-olfactory receptor, family 1, subfamily E, member 2 Gene |
| Size: | 2ug |
| Accessions: | BC121105 |
| Gene id: | 8388 |
| Gene description: | olfactory receptor, family 1, subfamily E, member 2 |
| Synonyms: | OR17-135; OR17-136; OR17-93; OR1E4; OR1E7; OST529; olfactory receptor 1E2; olfactory receptor 17-93/17-135/17-136; olfactory receptor 1E4; olfactory receptor OR17-17; olfactory receptor OR17-3; olfactory receptor, family 1, subfamily E, member 4; olfactory receptor, family 1, subfamily E, member 7; olfactory receptor family 1 subfamily E member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgggacaaaatcaaaccagcatctcagacttcctgctcctgggcctgcccatccaaccagagcagcaaaacctgcgctatgccctgttcttggccatgtatcttaccaccctcctggggaacctcctcatcattgtcctcattcgactggactcccatctccacacgcctgtgtatttgtttctcagcaacttgtccttctctgacctctgcttttcctcagtcacaatgcccaaattgctgcagaacatgcagaaccaagacccatccatcccctatgcagactgcctgacccaaatgtacttcttcttgtatttttcggatctagagagcttcctccttgtggccatggcctatgaccgctatgtggccatctgcttccccatgcactacaccgccatctgcttcctcctgcactacaccgccatcatgagccccatgctctgtctctccgtggtggcgctgtcctgggtgctgaccaccttccatgccatgttacacactttactcatggccaggttgtgtttttgtgcagacaatgtgatcccccactttttctgtgatatgtctgctctgctgaagctggcctgctctgacactcgagttaatgaatgggtgatatttatcatgggagggctcattcttgtcatcccattcctactcatccttgggtcctatgcaagaattgtctcctccatcctcaaggtcccttcttctaagggtatctgcaaggccttctctacttgtggctcccacctctctgtggtgtcactgttctatgggaccgttattggtctctacttatgcccatcagctaatagttctactctaaaggacactgtcatggctatgatgtacactgtggtgacccccatgctgacccccttcatctacagcctgaggaacagagacatgaagggagccctggaaagggtcatttgtaaaaggaaaaatcccttccttctatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - olfactory receptor, family 1, subfamily D, member 2 - olfactory receptor, family 3, subfamily A, member 1 - gamma-aminobutyric acid (GABA) A receptor, alpha 6 - glucose-fructose oxidoreductase domain containing 1 |