Cart 35 Product Products 11 772,75 € (empty)
-
-
1 x FITC-Linke...180,32 € -
-
-
-
1 x C16orf70-c...121,50 € -
1 x ZSCAN20-zi...121,50 € -
-
1 x F2R-coagul...121,50 € -
1 x ZSCAN2-zin...113,40 € -
-
1 x TM7SF2-tra...121,50 € -
1 x C22orf25-c...121,50 € -
1 x PILRA-pair...113,40 € -
-
1 x TM7SF2-tra...121,50 € -
1 x FAM160B2-f...121,50 € -
-
-
1 x Biotin-Lin...180,32 € -
1 x FITC-Linke...48,02 € -
1 x PIGA-phosp...121,50 € -
1 x RP1-21O18....121,50 € -
1 x TMED4-tran...113,40 € -
-
1 x PHTF2-puta...121,50 € -
1 x ELAVL3-ELA...121,50 € -
1 x CHMP2A-chr...113,40 € -
1 x RPL10A-rib...113,40 € -
1 x RPL17-ribo...113,40 € -
1 x ZRSR2-zinc...121,50 € -
1 x FAM119B-fa...113,40 € -
1 x TMCO3-tran...121,50 € -
1 x TMEM106C-t...113,40 € -
1 x CD37-CD37...121,50 €
No products
To be determined Shipping
11 772,75 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 35 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 11 772,75 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 11 772,75 €
Data sheet of STK19-serine/threonine kinase 19 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about STK19-serine/threonine kinase 19 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC121129 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | STK19 |
| Origin species: | Human |
| Product name: | STK19-serine/threonine kinase 19 Gene |
| Size: | 2ug |
| Accessions: | BC121129 |
| Gene id: | 8859 |
| Gene description: | serine/threonine kinase 19 |
| Synonyms: | D6S60; D6S60E; G11; HLA-RP1; RP1; serine/threonine-protein kinase 19; MHC class III HLA-RP1; nuclear serine/threonine protein kinase; serine/threonine kinase 19 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctggtatgtgcgtcgccaccgcccctcccagcactgacgggcctgagggacgacaagttgacgctcctttcgtcatcacctggtctaggagggacgcccggggagaccgtacgtcactgctctgcgccggaagaccctattttcaggttctcttccctccattcctaccccttccccggtaccataaaatcccgggatatgagctggaagaggcatcacctgatcccggagacctttggagttaagaggcggcggaagcgagggcctgtggagtcggatcctcttcggggtgagccagggtcggcgcgcgcggctgtctcagaactcatgcagctgttcccgcgaggcctgtttgaggacgcgctgccgcccatcgtgctgaggagccaggtgtacagccttgtgcctgacaggaccgtggccgaccggcagctgaaggagcttcaagagcagggggagatcagaatcgtccagctgggcttcgacttggatgcccatggaattatcttcactgaggactacaggaccagagtcctcaaggcctgtgatggccgaccgtatgctggggcagtgcagaaatttctagcttcagtacttccagcctgtggggaccttagtttccagcaggaccaaatgacacagacctttggcttcagggactcagaaatcacgcatctggtgaatgctggagtcctcaccgtccgagatgctgggagctggtggctagctgtgcctggagctgggagattcatcaagtactttgttaaagggcgccaggctgtccttagcatggtccggaaggcaaagtaccgggaactgctcctatcagagctcctgggccggcgggcgcctgtcgtggtgcggcttggcctcacctaccatgtgcacgacctcattggggcccagctagtggactgcatctctaccacttcaggaaccctcctccgcctgccagagacatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - free fatty acid receptor 2 - free fatty acid receptor 1 - chemokine-like receptor 1 - nasal embryonic LHRH factor |