Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of LAPTM5-lysosomal multispanning membrane protein 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LAPTM5-lysosomal multispanning membrane protein 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC106896 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LAPTM5 |
| Origin species: | Human |
| Product name: | LAPTM5-lysosomal multispanning membrane protein 5 Gene |
| Size: | 2ug |
| Accessions: | BC106896 |
| Gene id: | 7805 |
| Gene description: | lysosomal multispanning membrane protein 5 |
| Synonyms: | CLAST6; lysosomal-associated transmembrane protein 5; CD40-ligand-activated specific transcripts; human retinoic acid-inducible E3 protein; lysosomal associated multispanning membrane protein 5; lysosomal multispanning membrane protein 5; lysosomal-associated multitransmembrane protein 5; retinoic acid-inducible E3 protein; lysosomal protein transmembrane 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacccccgcttgtccactgtccgccagacctgctgctgcttcaatgtccgcatcgcaaccaccgccctggccatctaccatgtgatcatgagcgtcttgttgttcatcgagcactcggtagaggtggcccatggcaaggcgtcctgcaagctctcccagatgggctacctcaggatcgctgacctgatctccagcttcctgctcatcaccatgctcttcatcatcagcctgagcctactgatcggcgtagtcaagaaccgggagaagtacctgctgcccttcctgtccctgcaaatcatggactatctcctgtgcctgctcaccctgctgggctcctacattgagctgcccgcctacctcaagttggcctcccggagccgtgctagctcctccaagttccccctgatgacgctgcagctgctggacttctgcctgagcatcctgaccctctgcagctcctacatggaagtgcccacctatctcaacttcaagtccatgaaccacatgaattacctccccagccaggaggatatgcctcataaccagttcatcaagatgatgatcatcttttccatcgccttcatcactgtccttatcttcaaggtctacatgttcaagtgcgtgtggcggtgctacagattgatcaagtgcatgaactcggtggaggagaagaaaaactccaagatgctccagaaggtggtcctgccgtcctacgaggaagccctgtctttgccatcgaagaccccagaggggggcccagcaccacccccatactcagaggtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - inhibitor of CDK interacting with cyclin A1 - 5-hydroxytryptamine (serotonin) receptor 1B - serine/threonine protein kinase MST4 - ankyrin repeat and LEM domain containing 1 |