Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of LIN7A-lin-7 homolog A (C. elegans) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LIN7A-lin-7 homolog A (C. elegans) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC118609 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LIN7A |
| Origin species: | Human |
| Product name: | LIN7A-lin-7 homolog A (C. elegans) Gene |
| Size: | 2ug |
| Accessions: | BC118609 |
| Gene id: | 8825 |
| Gene description: | lin-7 homolog A (C. elegans) |
| Synonyms: | LIN-7A; LIN7; MALS-1; TIP-33; VELI1; protein lin-7 homolog A; mammalian LIN-7 1; mammalian lin-seven protein 1; tax interaction protein 33; vertebrate LIN7 homolog 1; lin-7 homolog A, crumbs cell polarity complex component |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgaagccgagcgtcacttcggctcccacggcagacatggcgacattgacagtggtccagccgctcaccctggacagagatgttgcaagagcaattgaattactggaaaaactacaggaatctggagaagtaccagtgcacaagctacaatccctcaaaaaagtgcttcagagtgagttttgtacagctattcgagaggtgtatcaatatatgcatgaaacgataactgttaatggctgtcccgaattccgtgcgagggcaacagcaaaggcaacagttgcagcttttgcagctagtgaaggccactcccaccctcgagtagttgaactgccaaagactgatgaaggccttggttttaatgtgatgggaggaaaggagcaaaattcccccatttatatctctcgcataattcctggaggggtggctgaaagacacggaggcctcaaaagaggagaccagctgctatcagtgaacggagtgagtgtggaaggagaacaccatgagaaagctgtggaactactcaaggctgctaaagacagcgtcaagctggtggtgcgatacaccccaaaagttctggaagaaatggaggctcgctttgaaaagctacgaacagccaggcgtcggcagcagcagcaattgctaattcagcagcagcaacagcagcagcagcaacaaacacaacaaaaccacatgtcatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - MAGI family member, X-linked - deltex 3 homolog (Drosophila) - sulfatase modifying factor 2 - RAR-related orphan receptor A |