Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MOBKL2C-MOB1, Mps One Binder kinase activator-like 2C (yeast) Gene
PTXBC121169
New product
Data sheet of MOBKL2C-MOB1, Mps One Binder kinase activator-like 2C (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MOBKL2C-MOB1, Mps One Binder kinase activator-like 2C (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC121169 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MOBKL2C |
| Origin species: | Human |
| Product name: | MOBKL2C-MOB1, Mps One Binder kinase activator-like 2C (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC121169 |
| Gene id: | 148932 |
| Gene description: | MOB1, Mps One Binder kinase activator-like 2C (yeast) |
| Synonyms: | MOBKL2C; MOB1E; MOB kinase activator 3C; MOB1, Mps One Binder kinase activator-like 2C; mob1 homolog 2C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccctgtgcctgaagcaggtgttcgccaaggacaagacgttccggccgcggaagcgctttgagccgggcacacagcgctttgagctgtacaagaaggcacaggcctctctcaagtcgggcctggacctgcgcagtgtggtgaggctaccacccggggagaacatcgacgactggatcgccgtgcacgtggtggacttcttcaaccgcatcaacctcatctacggcactatggcggagcgctgcagtgagaccagctgcccggtcatggccggcgggccccgctacgagtaccgctggcaggacgagcgccagtaccggcggcccgccaagctctctgcgccgcgctatatggcattgctcatggactggatcgaaggcctcatcaacgacgaagaggtctttcccacgcgtgttggagttcccttccctaagaacttccagcaggtctgcaccaagatcctgacccgcctcttccgagtctttgtccatgtctacatccaccacttcgatagcatcctcagcatgggggcagaggcgcacgtcaacacctgctacaagcacttctactacttcatccgcgagttcagtctggtggaccagcgggagctggagccactgagggagatgacagagcggatctgccactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - wingless-type MMTV integration site family, member 10B - solute carrier family 30 (zinc transporter), member 1 - UDP glucuronosyltransferase 2 family, polypeptide B11 - PMS1 postmeiotic segregation increased 1 (S. cerevisiae) |