Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of C3orf43-chromosome 3 open reading frame 43 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C3orf43-chromosome 3 open reading frame 43 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC118636 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C3orf43 |
| Origin species: | Human |
| Product name: | C3orf43-chromosome 3 open reading frame 43 Gene |
| Size: | 2ug |
| Accessions: | BC118636 |
| Gene id: | 255798 |
| Gene description: | chromosome 3 open reading frame 43 |
| Synonyms: | C3orf43; single-pass membrane and coiled-coil domain-containing protein 1; single-pass membrane protein with coiled-coil domains 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacaatgaaaccacaaccctgatatccttgaaggaggcaatgaaaagagtagaccacaaactccaagcgttagaaacacagttcaaagaactagacttcaccaaggataacctgatgcagaaattcgaacatcatagtaaggctttggcaagccaagcagcccaagatgagatgtggacagcagttcgggcactccagctcacttcaatggaattgaatattttatacagctacgtcattgaagtacttatctgcttgcatactcgtgtgcttgagaagctgccagacctggtgagaggtcttccaaccttagcctctgtactcagaagaaaagttaagaacaagcgcgttagagttgtatgggagtccatactggaggagtgtgggctgcaagaaggagacatcacagcactttgtaccttctttattgcacgtggtaacaaggcagaacactatactgctaaagtgaggcagatgtacatcagggatgtcacgttcctaattactaacatggtaaagaaccaggctctgcaggacagtttgctgagggctgtgcaggtaattgagaaggggaaagcagttaggacccctgaaaagcaaaagtcatccctcgaagagttgataccatctgtcaaaaactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 1 open reading frame 77 - chromosome 2 open reading frame 54 - protein arginine methyltransferase 1 - mesoderm posterior 2 homolog (mouse) |