Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PLA2G1B-phospholipase A2, group IB (pancreas) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PLA2G1B-phospholipase A2, group IB (pancreas) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC106725 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PLA2G1B |
| Origin species: | Human |
| Product name: | PLA2G1B-phospholipase A2, group IB (pancreas) Gene |
| Size: | 2ug |
| Accessions: | BC106725 |
| Gene id: | 5319 |
| Gene description: | phospholipase A2, group IB (pancreas) |
| Synonyms: | PLA2; PLA2A; PPLA2; phospholipase A2; phosphatidylcholine 2-acylhydrolase 1B; phospholipase A2, group IB (pancreas); phospholipase A2 group IB |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaactccttgtgctagctgtgctgctcacagtggccgccgccgacagcggcatcagccctcgggccgtgtggcagttccgcaaaatgatcaagtgcgtgatcccggggagtgaccccttcttggaatacaacaactacggctgctactgtggcttggggggctcaggcacccccgtggatgaactggacaagtgctgccagacacatgacaactgctatgaccaggccaagaagctggacagctgtaaatttctgctggacaacccgtacacccacacctattcatactcgtgctctggctcggcaatcacctgtagcagcaaaaacaaagagtgtgaggccttcatttgcaactgcgaccgcaacgctgccatctgcttttcaaaagctccatataacaaggcacacaagaacctggacaccaagaagtattgtcagagttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - D4, zinc and double PHD fingers family 1 - heparan sulfate 6-O-sulfotransferase 1 - regulator of G-protein signaling like 1 - cyclic nucleotide gated channel alpha 3 |