Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CXXC4-CXXC finger 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CXXC4-CXXC finger 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC119751 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CXXC4 |
| Origin species: | Human |
| Product name: | CXXC4-CXXC finger 4 Gene |
| Size: | 2ug |
| Accessions: | BC119751 |
| Gene id: | 80319 |
| Gene description: | CXXC finger 4 |
| Synonyms: | IDAX; CXXC-type zinc finger protein 4; CXXC finger 4; Dvl-binding protein IDAX (inhibition of the Dvl and Axin complex); inhibition of the Dvl and axin complex protein; CXXC finger protein 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaccaccgaaacgactcccagaggctggggaaagctggctgcccgccagagccgtcgttgcaaatggcaaatactaatttcctctccaccttatcccctgaacactgcagacctttggcgggggaatgcatgaacaagctcaaatgcggcgctgctgaagcagagataatgaatctccccgagcgcgtggggactttttccgctatcccggctttagggggcatctcattacctccaggggtcatcgtcatgacagcccttcactcccccgcagcagcctcagcagccgtcacagacagtgcgtttcaaattgccaatctggcagactgcccgcagaatcattcctcctcctcctcgtcctcctcagggggagctggcggagccaacccagccaagaagaagaggaaaaggtgtggggtctgcgtgccctgcaagaggctcatcaactgtggcgtctgcagcagttgcaggaaccgcaaaacgggacaccagatctgcaaatttagaaaatgtgaagagctaaagaaaaaacctggcacttcactagagagaacacctgttcccagcgctgaagcattccgatggttcttttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Nbla00301 - neurotrophin 3 - homeobox D12 - formin-like 1 |