Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MUTED-muted homolog (mouse) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MUTED-muted homolog (mouse) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC119644 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MUTED |
| Origin species: | Human |
| Product name: | MUTED-muted homolog (mouse) Gene |
| Size: | 2ug |
| Accessions: | BC119644 |
| Gene id: | 63915 |
| Gene description: | muted homolog (mouse) |
| Synonyms: | protein Muted homolog; muted homolog; biogenesis of lysosomal organelles complex-1, subunit 5, muted; MUTED; BLOS5; biogenesis of lysosome-related organelles complex 1 subunit 5; BLOC-1 subunit 5; biogenesis of lysosomal organelles complex 1 subunit 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtggcggagggacagagacccctgtgggttgtgaggccgccccgggcggtggcagcaagaagagggactccctggggactgcgggctcagcgcacctcattatcaaggatcttggagaaattcattcaaggcttttggatcacagaccagttattcaaggtgaaactcgttattttgtaaaagaatttgaagaaaaacgtggtcttcgagaaatgcgagttcttgaaaatttgaagaacatgatccatgaaacaaatgaacatactcttcccaaatgtagagacacaatgcgggacagcctcagccaggttctccagagattgcaagcagctaatgactcagtctgtagactccaacagagggaacaggaacgaaaaaagattcatagtgaccacttagtagctagtgagaaacagcatatgctccagtgggacaacttcatgaaggagcaacccaacaaaagggctgaagtggatgaagagcacagaaaagccatggaaaggcttaaagaacaatatgctgagatggagaaggacctagcgaaattttcaaccttttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - caudal type homeobox 1 - interferon, alpha 10 - SLAM family member 8 - SLAM family member 6 |