LOC729862-similar to Striatin Gene View larger

LOC729862-similar to Striatin Gene

PTXBC121073

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC729862-similar to Striatin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOC729862-similar to Striatin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC121073
Product type: DNA & cDNA
Ncbi symbol: LOC729862
Origin species: Human
Product name: LOC729862-similar to Striatin Gene
Size: 2ug
Accessions: BC121073
Gene id: 729862
Gene description: similar to Striatin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcaacaaaagcttctgggagcagaagggaggctccaagacctcatcaacaattacggcccagattgccttcctacagggagaaaggaagggccaagaaaatttgaagaaggatctcgtgaggatgatcagaatgttggagtatgctcttaaacagaaaagagccaaataccacaagttgaaatatgggacagaattgaatcagggagctatgaagcctccaagctatgattctgatgaaggtaatgaaacagaagtgcagccacaacaaaacagccagttaatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - programmed cell death 6
- hypothetical LOC65996
- Fer3-like (Drosophila)
- RWD domain containing 3

Reviews

Buy LOC729862-similar to Striatin Gene now

Add to cart