Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of BAGE-B melanoma antigen Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BAGE-B melanoma antigen Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC107038 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BAGE |
| Origin species: | Human |
| Product name: | BAGE-B melanoma antigen Gene |
| Size: | 2ug |
| Accessions: | BC107038 |
| Gene id: | 574 |
| Gene description: | B melanoma antigen |
| Synonyms: | BAGE1; CT2.1; B melanoma antigen 1; antigen MZ2-BA; cancer/testis antigen 2.1; cancer/testis antigen family 2, member 1; B melanoma antigen |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggccagagcggtttttctggcattgtctgcccagctgctccaagccaggctgatgaaggaggagtcccctgtggtgagctggaggttggagcctgaagacggcacagctctgtgcttcatcttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - F-box protein 32 - F-box protein 34 - F-box protein 10 - protocadherin 10 |