Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of BEX5-brain expressed, X-linked 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BEX5-brain expressed, X-linked 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC106955 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BEX5 |
| Origin species: | Human |
| Product name: | BEX5-brain expressed, X-linked 5 Gene |
| Size: | 2ug |
| Accessions: | BC106955 |
| Gene id: | 340542 |
| Gene description: | brain expressed, X-linked 5 |
| Synonyms: | protein BEX5; NGFRAP1L1; BEX family member 5; NGFRAP1-like 1; NGFRAP1-like protein 1; brain-expressed X-linked protein 5; nerve growth factor receptor-associated protein 2; brain expressed X-linked 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaaatgtccccaaggaaaacaaagttgtggagaaggccccagtgcagaatgaagcccccgctttaggaggtggtgaataccaggagcctggaggaaatgttaaaggggtttgggctccacctgccccgggttttggagaggatgtgcccaataggcttgtcgataacattgatatgatagatggagatggagatgatatggaacggttcatggaggagatgagagagctaaggaggaaaattagggaacttcagttgaggtacagtctgcgcattcttataggggaccctcctcaccatgatcatcatgatgagttttgccttatgccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - late cornified envelope 2A - late cornified envelope 1B - hypothetical LOC339788 - hypothetical LOC148413 |