Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TXNDC8-thioredoxin domain containing 8 (spermatozoa) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TXNDC8-thioredoxin domain containing 8 (spermatozoa) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130549 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TXNDC8 |
| Origin species: | Human |
| Product name: | TXNDC8-thioredoxin domain containing 8 (spermatozoa) Gene |
| Size: | 2ug |
| Accessions: | BC130549 |
| Gene id: | 255220 |
| Gene description: | thioredoxin domain containing 8 (spermatozoa) |
| Synonyms: | SPTRX-3; TRX6; bA427L11.2; thioredoxin domain-containing protein 8; sperm-specific thioredoxin 3; spermatid-specific thioredoxin-3; spermatocyte/spermatid-specific thioredoxin-3; thioredoxin 6; thioredoxin domain containing 8 (spermatozoa); thioredoxin domain containing 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtacagattattaaagacacgaatgaatttaaaacatttttgacagctgccggacacaaactcgcagtggttcaattttcttcgaaacggtgtggtccctgcaaaaggatgtttcctgttttccatgctatgtctgtgaaataccaaaatgtattttttgctaatgtggatgtgaacaattctccggagctggctgaaacttgtcacatcaaaacaatacccacatttcagatgttcaagaaaagccagaaggtaaccctattctcaagaatcaaaagaataatttgctgttatagaagtggattcatgagcaacctgtgtcttgcagatgatggaaatgagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - H2B histone family, member W, testis-specific - nuclear transport factor 2-like export factor 2 - progestin and adipoQ receptor family member IX - fucosyltransferase 2 (secretor status included) |