No products
Prices are tax excluded
PTXBC104473
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC104473 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LOC100049076 |
| Origin species: | Human |
| Product name: | LOC100049076-similar to SMA4 Gene |
| Size: | 2ug |
| Accessions: | BC104473 |
| Gene id: | 100049076 |
| Gene description: | similar to SMA4 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgattgctcacaccaaagccttggacccctcccagcctgtgacctttgggaccaactccacctacgcagcagacaagggggctctgtatgtggatgtgatccgtgtgaacagctactactcttggtatcgcaactacgggcacctggagttgattcggctgcagctggccgcccagtttgagaattggtgtaagacatcacaatcccattattcagagcgcgtatggagtggaaacgcttgtagggcttcaccaggtaagcggtgttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - PR domain containing 7 - melanocortin 3 receptor - PR domain containing 5 - Bardet-Biedl syndrome 1 |