Cart 6 Product Products 888,18 € (empty)
-
1 x TRIM38-tri...121,50 € -
1 x KLK8-kalli...113,40 € -
1 x UBR2-ubiqu...121,50 € -
1 x Donkey...269,00 € -
1 x NOP10-NOP1...113,40 € -
No products
To be determined Shipping
888,18 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 888,18 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 888,18 €
Data sheet of SPRR2A-small proline-rich protein 2A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPRR2A-small proline-rich protein 2A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC096108 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPRR2A |
| Origin species: | Human |
| Product name: | SPRR2A-small proline-rich protein 2A Gene |
| Size: | 2ug |
| Accessions: | BC096108 |
| Gene id: | 6700 |
| Gene description: | small proline-rich protein 2A |
| Synonyms: | small proline-rich protein 2A; SPR-2A; small proline rich protein 2A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcttatcaacagcagcagtgcaagcagccctgccagccacctcctgtgtgccccacgccaaagtgcccagaaccatgtccacccccgaagtgccctgagccctgcccaccaccaaagtgtccacagccctgcccacctcagcagtgccagcagaaatatcctcctgtgacaccttccccaccctgccagtcaaagtatccaccgaagagcaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glycophorin B (MNS blood group) - disrupted in renal carcinoma 1 - interferon, beta 1, fibroblast - SH3 and cysteine rich domain 2 |