Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RETNLB-resistin like beta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RETNLB-resistin like beta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113502 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RETNLB |
| Origin species: | Human |
| Product name: | RETNLB-resistin like beta Gene |
| Size: | 2ug |
| Accessions: | BC113502 |
| Gene id: | 84666 |
| Gene description: | resistin like beta |
| Synonyms: | FIZZ1; FIZZ2; HXCP2; RELM-beta; RELMb; RELMbeta; XCP2; resistin-like beta; C/EBP-epsilon regulated myeloid-specific secreted cysteine-rich protein precursor 2; colon and small intestine-specific cysteine-rich protein; colon carcinoma-related gene protein; cysteine-rich secreted A12-alpha-like protein 1; cysteine-rich secreted protein A12-alpha-like 1; cysteine-rich secreted protein FIZZ2; found in inflammatory zone 1; resistin like beta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggccgtcctcttgcctccttctcatcctaatcccccttctccagctgatcaacccggggagtactcagtgttccttagactccgttatggataagaagatcaaggatgttctcaacagtctagagtacagtccctctcctataagcaagaagctctcgtgtgctagtgtcaaaagccaaggcagaccgtcctcctgccctgctgggatggctgtcactggctgtgcttgtggctatggctgtggttcgtgggatgttcagctggaaaccacctgccactgccagtgcagtgtggtggactggaccactgcccgctgctgccacctgacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - crystallin, gamma A - interferon, alpha 6 - chymase 1, mast cell - butyrophilin-like 8 |