Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of H2BFS-H2B histone family, member S Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about H2BFS-H2B histone family, member S Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC126339 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | H2BFS |
| Origin species: | Human |
| Product name: | H2BFS-H2B histone family, member S Gene |
| Size: | 2ug |
| Accessions: | BC126339 |
| Gene id: | 54145 |
| Gene description: | H2B histone family, member S |
| Synonyms: | H2bfs; 2610022J01Rik; R74621; histone H2B type 1-C/E/G; H2B histone family, member S; histone 1, H2bc; histone cluster 1, H2bc |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccggagccagcgaagtccgctcccgcgcccaagaagggctcgaagaaagccgtgactaaggcgcagaagaaggacggcaggaagcgcaagcgcagccgcaaggagagctactccgtatacgtgtacaaggtgctgaagcaggtccaccccgacaccggcatctcctctaaggccatgggaatcatgaactccttcgtcaacgacatcttcgaacgcatcgcaggtgaggcttcccgcctgccgcattacaacaagcgctcgaccatcacctccagggagatccagacggccgtgcgcctgctgctgcccggggagttggccaagcacgccgtgtccgagggcaccaaggccgtcaccaagtacaccagcgctaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - H2B histone family, member S - thymosin-like 1 (pseudogene) - gastric inhibitory polypeptide - Charcot-Leyden crystal protein |